ID: 1051135407

View in Genome Browser
Species Human (GRCh38)
Location 9:13914606-13914628
Sequence ATGTGGTTCTTGAGGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135407_1051135412 2 Left 1051135407 9:13914606-13914628 CCTTGGTCCCTCAAGAACCACAT No data
Right 1051135412 9:13914631-13914653 AGAAGAGCTGCTCACTGACCGGG No data
1051135407_1051135411 1 Left 1051135407 9:13914606-13914628 CCTTGGTCCCTCAAGAACCACAT No data
Right 1051135411 9:13914630-13914652 TAGAAGAGCTGCTCACTGACCGG No data
1051135407_1051135414 25 Left 1051135407 9:13914606-13914628 CCTTGGTCCCTCAAGAACCACAT No data
Right 1051135414 9:13914654-13914676 AGTTAACCTTATTTATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135407 Original CRISPR ATGTGGTTCTTGAGGGACCA AGG (reversed) Intergenic
No off target data available for this crispr