ID: 1051135793

View in Genome Browser
Species Human (GRCh38)
Location 9:13919093-13919115
Sequence GAGGCAGAAACCAGGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135793_1051135800 21 Left 1051135793 9:13919093-13919115 CCAGCAAACCTGGTTTCTGCCTC No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data
1051135793_1051135799 2 Left 1051135793 9:13919093-13919115 CCAGCAAACCTGGTTTCTGCCTC No data
Right 1051135799 9:13919118-13919140 TGCAATTAGGTGGCTCAATTTGG No data
1051135793_1051135796 -8 Left 1051135793 9:13919093-13919115 CCAGCAAACCTGGTTTCTGCCTC No data
Right 1051135796 9:13919108-13919130 TCTGCCTCCATGCAATTAGGTGG No data
1051135793_1051135801 29 Left 1051135793 9:13919093-13919115 CCAGCAAACCTGGTTTCTGCCTC No data
Right 1051135801 9:13919145-13919167 GCCCCACCATAATGGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135793 Original CRISPR GAGGCAGAAACCAGGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr