ID: 1051135797

View in Genome Browser
Species Human (GRCh38)
Location 9:13919112-13919134
Sequence TGAGCCACCTAATTGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135797_1051135806 24 Left 1051135797 9:13919112-13919134 CCTCCATGCAATTAGGTGGCTCA No data
Right 1051135806 9:13919159-13919181 GCTCAGAGGACTCCCCATTTTGG No data
1051135797_1051135801 10 Left 1051135797 9:13919112-13919134 CCTCCATGCAATTAGGTGGCTCA No data
Right 1051135801 9:13919145-13919167 GCCCCACCATAATGGCTCAGAGG No data
1051135797_1051135800 2 Left 1051135797 9:13919112-13919134 CCTCCATGCAATTAGGTGGCTCA No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135797 Original CRISPR TGAGCCACCTAATTGCATGG AGG (reversed) Intergenic
No off target data available for this crispr