ID: 1051135798

View in Genome Browser
Species Human (GRCh38)
Location 9:13919115-13919137
Sequence AATTGAGCCACCTAATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135798_1051135801 7 Left 1051135798 9:13919115-13919137 CCATGCAATTAGGTGGCTCAATT No data
Right 1051135801 9:13919145-13919167 GCCCCACCATAATGGCTCAGAGG No data
1051135798_1051135806 21 Left 1051135798 9:13919115-13919137 CCATGCAATTAGGTGGCTCAATT No data
Right 1051135806 9:13919159-13919181 GCTCAGAGGACTCCCCATTTTGG No data
1051135798_1051135800 -1 Left 1051135798 9:13919115-13919137 CCATGCAATTAGGTGGCTCAATT No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135798 Original CRISPR AATTGAGCCACCTAATTGCA TGG (reversed) Intergenic
No off target data available for this crispr