ID: 1051135800

View in Genome Browser
Species Human (GRCh38)
Location 9:13919137-13919159
Sequence TTGGAAAAGCCCCACCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135793_1051135800 21 Left 1051135793 9:13919093-13919115 CCAGCAAACCTGGTTTCTGCCTC No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data
1051135797_1051135800 2 Left 1051135797 9:13919112-13919134 CCTCCATGCAATTAGGTGGCTCA No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data
1051135794_1051135800 13 Left 1051135794 9:13919101-13919123 CCTGGTTTCTGCCTCCATGCAAT No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data
1051135798_1051135800 -1 Left 1051135798 9:13919115-13919137 CCATGCAATTAGGTGGCTCAATT No data
Right 1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135800 Original CRISPR TTGGAAAAGCCCCACCATAA TGG Intergenic
No off target data available for this crispr