ID: 1051142669

View in Genome Browser
Species Human (GRCh38)
Location 9:13994663-13994685
Sequence GTTCATCCAATCCCAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051142669_1051142670 7 Left 1051142669 9:13994663-13994685 CCATGCTTTGGGATTGGATGAAC No data
Right 1051142670 9:13994693-13994715 AAGCATTTTTTGCATCCTGCTGG 0: 2
1: 97
2: 91
3: 71
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051142669 Original CRISPR GTTCATCCAATCCCAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr