ID: 1051142670

View in Genome Browser
Species Human (GRCh38)
Location 9:13994693-13994715
Sequence AAGCATTTTTTGCATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 2, 1: 97, 2: 91, 3: 71, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051142669_1051142670 7 Left 1051142669 9:13994663-13994685 CCATGCTTTGGGATTGGATGAAC No data
Right 1051142670 9:13994693-13994715 AAGCATTTTTTGCATCCTGCTGG 0: 2
1: 97
2: 91
3: 71
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051142670 Original CRISPR AAGCATTTTTTGCATCCTGC TGG Intergenic
902061037 1:13643048-13643070 AAGTGTTTTCTGCATCCTGCCGG + Intergenic
902421379 1:16283171-16283193 AATCATTTTTTGCATTCTCTGGG - Intronic
902620850 1:17650064-17650086 TCGCATTTTTTGGATCCTTCTGG + Intronic
903979213 1:27173360-27173382 AAGCATTTTCTGCATCCTGCTGG + Intergenic
906367742 1:45224827-45224849 AAGCATTTTCTGCATCCTGCCGG - Intronic
906438449 1:45817967-45817989 AAGAATGTTCTGCATCCTGCTGG + Intronic
907847059 1:58218458-58218480 AGGCATGTTTTGCTTCCTGAAGG + Intronic
909606713 1:77515456-77515478 AATCATGTTTTGCATGCTGATGG + Intronic
909902350 1:81153623-81153645 AAGCATTTTTTGCATGCTACTGG - Intergenic
910051035 1:82974180-82974202 AAGCACTTTTTGCATTCTACTGG + Intergenic
910148045 1:84105881-84105903 TAGCATTTTTTGAATACTGTTGG + Intronic
910749906 1:90617914-90617936 AAGCATTTTCTGCATCTTGCTGG + Intergenic
910800838 1:91144159-91144181 AAGCATTTTCTGCATCCTGCTGG + Intergenic
910903513 1:92148534-92148556 CAGCATGTATTGCATCCTGGAGG - Intergenic
911702979 1:100976627-100976649 AATAATTGTTTCCATCCTGCAGG - Exonic
912152594 1:106878697-106878719 AAGCATTTTCTGCATCCTTCTGG - Intergenic
912723573 1:112040187-112040209 TAGCATTTGTTGGCTCCTGCTGG + Intergenic
915032778 1:152897948-152897970 AAGCATTTTCTTCACCCTGCTGG + Intergenic
915388104 1:155515366-155515388 AAGGATTTTACGCATCCTGCTGG - Intronic
916870550 1:168910074-168910096 AAGCATTTTCTGTATCCTGCTGG - Intergenic
917226779 1:172791813-172791835 AAACATTTTTTGCATTCATCAGG + Intergenic
917816795 1:178719323-178719345 TAGCATTTTTTTCCTCCTCCAGG + Intergenic
918808568 1:189084099-189084121 ATGCATTTTCTGCCTCCTGTAGG - Intergenic
918914532 1:190617532-190617554 AAGCATTTTCTGCATCTTGCTGG + Intergenic
919274657 1:195398038-195398060 AAGCATTTTCTGCATCCTGCTGG + Intergenic
920630739 1:207649129-207649151 AAGCATTTTCTGCCTCCCCCTGG - Intronic
920641517 1:207756063-207756085 AAGCATTTTCTGCCTCCCCCTGG - Intronic
921057126 1:211551249-211551271 AAGCATTTTCTGCATCCTACTGG - Intergenic
921750496 1:218787297-218787319 AAGCATTTTCTGCACCCTGCTGG + Intergenic
922174282 1:223183828-223183850 AAGCATTTTTTGCACCCTGCTGG + Intergenic
924417573 1:243873464-243873486 AAGCATTTTTTGCATCTATTGGG + Intergenic
924773176 1:247094525-247094547 AAGCATTTTCTGCATCATGCTGG - Intergenic
1063338618 10:5241893-5241915 AAGCATTTTCTGTATCAAGCTGG - Intergenic
1063548914 10:7009915-7009937 AATACTTTTCTGCATCCTGCTGG - Intergenic
1064330538 10:14389986-14390008 AAGCATTTTCTGCATCCTGCTGG - Intronic
1064749543 10:18512746-18512768 AAGCACTTTCTGCATCCTGCTGG + Intronic
1067574408 10:47400067-47400089 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1067933037 10:50582638-50582660 AAGAAATTTTTCCATCCTGCCGG - Intronic
1068040029 10:51812234-51812256 AAGCATTTTCTGCATCCTGCTGG + Intronic
1068316678 10:55353169-55353191 AAGCATTTTCTGCATTCTCCTGG - Intronic
1068828201 10:61463433-61463455 AAGTATTTTATGCACCCTGGAGG + Intergenic
1069520428 10:69115553-69115575 AAACATTTTCTGCATTCTACTGG - Intergenic
1070644763 10:78194214-78194236 AAGCCTTCTTTGAATCCTCCAGG - Intergenic
1071389501 10:85157221-85157243 AAGCATTTTCTGCATCCTACTGG - Intergenic
1071442439 10:85713672-85713694 AAGCCATTCTTGCATCCTGGGGG - Intronic
1072042273 10:91619416-91619438 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1073757342 10:106594743-106594765 AAGCAAATTTTGCATCATGAAGG + Intronic
1074444621 10:113509911-113509933 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1075352572 10:121737067-121737089 AAGCATTAATTGCATACTGCTGG + Intergenic
1075816518 10:125268823-125268845 AAGCATTTGCTGCATCTGGCAGG - Intergenic
1076205250 10:128593711-128593733 AAGCATTTTCTGCATGCTGCTGG + Intergenic
1077852691 11:6089383-6089405 AAGCATTTTTTGCATTCTTTTGG - Intergenic
1078156800 11:8806787-8806809 AGGCATTTGTTTCATCCTGGAGG - Intronic
1078244074 11:9557337-9557359 AATCATTTTCTGCATCCTGCTGG - Intergenic
1078283693 11:9929788-9929810 AAGCATTTTCTGCATCCTGCTGG - Intronic
1080602477 11:33833289-33833311 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1080795884 11:35562937-35562959 AAGCATCTTTAGCATCCTCTAGG - Intergenic
1082304207 11:50550939-50550961 AACCAGTTTTTCCATACTGCTGG + Intergenic
1082700938 11:56429604-56429626 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1083408722 11:62477147-62477169 AAGCATTTTCTGCATCCTGCTGG - Intronic
1084819504 11:71675173-71675195 CACCATTTTGTTCATCCTGCGGG + Intergenic
1085352093 11:75804716-75804738 AAGAATTGTTTGAATCCAGCTGG + Intergenic
1085509207 11:77077990-77078012 AAACATTTTTCCCATTCTGCAGG + Intronic
1086251886 11:84825724-84825746 ATATAATTTTTGCATCCTGCTGG - Intronic
1086436746 11:86788934-86788956 GAGCATTTTCTGCATCCTGCTGG + Intergenic
1087564064 11:99831264-99831286 AAGCATTTTCTGCATCCTCCTGG + Intronic
1087792397 11:102420408-102420430 AAGTATTCTTTGAATACTGCTGG - Intronic
1088096475 11:106106504-106106526 AAGAATTTTCTGCATCCTGCTGG + Intergenic
1088348529 11:108858211-108858233 AAGCCTTTTCTGCCTCCTTCAGG + Intronic
1088356187 11:108946214-108946236 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1088741663 11:112772624-112772646 AGGTATTTTCTGAATCCTGCAGG - Intergenic
1090214474 11:124949322-124949344 AAGTATTTTCTGCATCCTGCTGG + Intergenic
1090511360 11:127378714-127378736 AAACATGTTTTGCAATCTGCTGG - Intergenic
1090595569 11:128317420-128317442 AAGCAGTTTATGGATCCTGCTGG + Intergenic
1090856233 11:130611219-130611241 AATCTTTCTTTGCATCCTCCAGG - Intergenic
1091683581 12:2544683-2544705 AAGCATTTTCTGCATCCTGCTGG + Intronic
1092909562 12:13134708-13134730 AGGCCTTTTTTGCATCCTGCTGG - Intronic
1093356122 12:18170139-18170161 AAGCATTTTCTGCATCTTGCTGG + Intronic
1093442984 12:19221609-19221631 AAGGATTTTTTGCATACGGTCGG - Intronic
1093547228 12:20362662-20362684 AGGCATTTTTTTCATTCTACCGG - Intergenic
1093677261 12:21957915-21957937 AAGCATTTTCTGCCTCCTGCTGG - Intergenic
1094245807 12:28291203-28291225 AAGCATTTTCTGCACCCTGCTGG + Intronic
1094554549 12:31485349-31485371 AAGCATTTTCTGCATCCTGCTGG - Intronic
1094619121 12:32063183-32063205 AACCAATTTTTCCATCCAGCTGG + Intergenic
1095419801 12:42013162-42013184 AAGCCTTTTTTAAATGCTGCTGG + Intergenic
1097796277 12:63865524-63865546 AAGCATTTTCTGCATCCTGCTGG + Intronic
1097846918 12:64376288-64376310 AAGCATTTTCTGCATCCTGCTGG - Intronic
1097975498 12:65682172-65682194 AAGCATCTTTTGCATTCAACTGG - Intergenic
1098137906 12:67421998-67422020 GAGCATTTTCTGCATCCTGCTGG - Intergenic
1099672238 12:85709172-85709194 AAGCATTTTCTGCATCTTGCTGG - Intergenic
1100527704 12:95435345-95435367 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1101275906 12:103200964-103200986 AAGCAATTTCTGCATCCTGCTGG + Intergenic
1101602640 12:106223987-106224009 AGGCTTTTTTTTCCTCCTGCTGG + Intergenic
1102073594 12:110042427-110042449 AACCATTTTCAGCATCCTGCTGG - Exonic
1103978280 12:124718422-124718444 AAGCGCTTTCTGCATCCTGCTGG - Intergenic
1104905479 12:132211228-132211250 AAGCATTTTCTGCATCCTGCTGG - Intronic
1105271885 13:18884288-18884310 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1105807990 13:23969110-23969132 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1106424652 13:29614618-29614640 AAGGATGTTCTGCAGCCTGCAGG + Intergenic
1106449962 13:29872016-29872038 AAGCATTTTCTGCATCTTGCTGG - Intergenic
1106961415 13:35002793-35002815 GTGCATTTTTTGCATCCTGCTGG + Intronic
1107103148 13:36615654-36615676 AAGCATTTTCTGCATTCTGCTGG + Intergenic
1107577321 13:41740654-41740676 CAGCATTTTCTGACTCCTGCTGG + Intronic
1107881450 13:44835469-44835491 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1108290128 13:48951046-48951068 AAACATCTTTTGCAATCTGCTGG - Intergenic
1108326614 13:49338845-49338867 AAGTATTTTAAGCAACCTGCAGG + Intronic
1109688345 13:65850337-65850359 AAGCATTTTCTGCACTCTGCTGG + Intergenic
1110545825 13:76754280-76754302 AAGGATTTTCTGCAATCTGCTGG - Intergenic
1112542572 13:100330121-100330143 GAGCATTTTTTGCATCCTGCTGG - Intronic
1112940571 13:104856123-104856145 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1113478635 13:110603937-110603959 AAGCACTTTCTGCATGCTGCTGG + Intergenic
1113556997 13:111244909-111244931 AAGCACTTTCTGCATCCTGCTGG + Intronic
1113740318 13:112708182-112708204 AAGCATTTTCTGCATCCTGCTGG - Intronic
1114565511 14:23629550-23629572 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1116108829 14:40549224-40549246 AAGTATTTTCTTCATCCTGGGGG + Intergenic
1116545207 14:46156859-46156881 GAGCCTTTATTGCATCTTGCTGG - Intergenic
1117989310 14:61418222-61418244 AAGCATGTTTTGCATCTGACAGG + Intronic
1118490701 14:66256599-66256621 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1118599384 14:67461099-67461121 AAGCATTTCTGGAATCCTGCTGG - Intronic
1119974007 14:79004898-79004920 GAGTATTTTTTACATCCTGAAGG - Intronic
1120275339 14:82366432-82366454 AAGTATTTTCTGCATCCTGCTGG - Intergenic
1120541543 14:85757303-85757325 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1121805700 14:96819701-96819723 AAGCATTTTCTGCATCCTGCTGG + Intronic
1121881494 14:97504707-97504729 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1121999078 14:98631207-98631229 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1123486330 15:20742961-20742983 AAGCATTTTCTGCATCCTGATGG - Intergenic
1123542818 15:21312011-21312033 AAGCATTTTCTGCATCCTGATGG - Intergenic
1123889322 15:24759918-24759940 AAGCATTCTCTGTATCCTGCTGG + Intergenic
1125052383 15:35315282-35315304 AAGCATTTTCTGCATTCTGCTGG - Intronic
1125622195 15:41073448-41073470 AAGCATTTTCAGCATTCTTCAGG + Exonic
1126060761 15:44779822-44779844 ATGCATTTTTACCAACCTGCTGG - Intergenic
1126437276 15:48648184-48648206 CAGCATGTCTTGCATGCTGCTGG - Intergenic
1126641954 15:50836689-50836711 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1126885378 15:53143517-53143539 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1127769557 15:62220105-62220127 AAGCATTTTCTGCATACTGCTGG - Intergenic
1129380930 15:75165748-75165770 AAAGATTTTCTGCATCCTACTGG + Intergenic
1130854404 15:87828607-87828629 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1131329919 15:91487451-91487473 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1131461995 15:92624090-92624112 AAGCAATATTGGCAGCCTGCGGG - Intronic
1131752213 15:95522483-95522505 AAGCATTACTTGCATTTTGCAGG - Intergenic
1202951137 15_KI270727v1_random:39141-39163 AAGCATTTTCTGCATCCTGATGG - Intergenic
1132938655 16:2496012-2496034 AAGTGTTTTTTTAATCCTGCAGG + Exonic
1134390657 16:13816920-13816942 AAGCTGTTTTGGCATCTTGCAGG - Intergenic
1135071135 16:19352862-19352884 GAGCATTTTCTACAGCCTGCAGG + Intergenic
1135942015 16:26830180-26830202 AAGCAGTGTTGCCATCCTGCTGG + Intergenic
1136528684 16:30851111-30851133 AAGCATTTTCTGCATCCTACTGG + Intronic
1137736463 16:50727545-50727567 AAGCATTTTCTGCATCCTCCTGG + Intronic
1138834489 16:60417247-60417269 AAGGATTTTCTGGATCCTGCTGG + Intergenic
1140156755 16:72437224-72437246 AATCATTTATTTCATCCTTCTGG - Intergenic
1141919874 16:87128517-87128539 AAGCATCTTGTGGGTCCTGCTGG + Intronic
1142972300 17:3621123-3621145 TAGCAGTCTTGGCATCCTGCTGG - Intronic
1143267032 17:5645990-5646012 AATTATATTTTGCATACTGCTGG + Intergenic
1143277871 17:5727028-5727050 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1144061428 17:11586173-11586195 AAGTATTTCTTTCATCCTTCTGG + Intergenic
1144230123 17:13193835-13193857 GAGAACTTTTTGCGTCCTGCAGG - Intergenic
1144275594 17:13665450-13665472 AAGCATTTTCTGAATTCTGCTGG - Intergenic
1149167260 17:53767362-53767384 AAGCATTTTCTACATCCTGATGG + Intergenic
1149218298 17:54384966-54384988 ACCCATTTTCTGCATCCTGCTGG + Intergenic
1150023518 17:61646572-61646594 AATCATTTCATGCATCCTTCAGG + Intergenic
1152487052 17:80601317-80601339 AATCATTTTCTCCTTCCTGCAGG - Intronic
1153448717 18:5201793-5201815 AAGCAGTTTATGAGTCCTGCTGG + Intergenic
1153705239 18:7738294-7738316 AAGCATTTTCTGCATTCTGCTGG + Intronic
1154509960 18:15087829-15087851 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1155055767 18:22181795-22181817 TAGCATTTTTTGTTTCCTACTGG - Intronic
1155777989 18:29792678-29792700 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1155794251 18:30014196-30014218 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1156173331 18:34512795-34512817 AAGCATTGTTTGCATCTTGCAGG + Intronic
1156713770 18:39981322-39981344 AAGCAATTCTTGCATTCTGATGG - Intergenic
1157516417 18:48314884-48314906 AGGCATTGTTTGCAGCCAGCAGG + Intronic
1159324453 18:66896265-66896287 AAGGATTTTCTGCATCCTGCTGG + Intergenic
1159722996 18:71916538-71916560 AAGCATTTTCTGCATCCTACTGG - Intergenic
1160400051 18:78603603-78603625 AAGTATTTTTGGAATCCTGTTGG - Intergenic
1161081618 19:2313198-2313220 CAGTTTCTTTTGCATCCTGCAGG - Intronic
1163327779 19:16616238-16616260 CAGCATTTTTTACATCTTTCTGG + Intronic
925048384 2:791573-791595 AAACATTTTCTGCATCCTGTTGG + Intergenic
925080974 2:1066194-1066216 AAGCATTTTCTGCATTCTGCTGG + Intronic
926405918 2:12552539-12552561 AAGCATTTTCTGCATCCTGCTGG + Intergenic
926758628 2:16256558-16256580 AAGCATTTTCTGCATCCTGCTGG - Intergenic
926768117 2:16341648-16341670 AAGCATTTTCTGCATTCTGCTGG - Intergenic
927514904 2:23666494-23666516 AAGCAACTTCTGCAACCTGCTGG - Intronic
929894720 2:45949226-45949248 AAGCAACTCTTGCATACTGCCGG - Intronic
930228368 2:48818005-48818027 AAGTATTTATTGCTTCCTGTAGG + Intergenic
930326354 2:49924217-49924239 AATCATTTTTTCCAGCCTGATGG + Intronic
933450762 2:82447329-82447351 AAGCATTTTCTGCATCCTGTTGG - Intergenic
933542641 2:83667062-83667084 AAGTGTTTTCTGCATCCTTCTGG + Intergenic
934538305 2:95155153-95155175 AAGCAGCTTTTTCATCCTGCTGG - Intronic
935037675 2:99395054-99395076 AAGACTTGTTTGCATACTGCTGG - Intronic
935355984 2:102200352-102200374 AATTATTTACTGCATCCTGCTGG + Intronic
935440353 2:103087516-103087538 AAATATTTTCTGCATCCTACTGG + Intergenic
935541807 2:104357096-104357118 AAGTATTTTCTGCATCCTGCTGG - Intergenic
936774447 2:115955901-115955923 AAGCATTTTCTGCATCCTGCTGG + Intergenic
937707687 2:124940220-124940242 AAACATTTTCTGCATCTTGCTGG - Intergenic
937771988 2:125730017-125730039 AAACATTTTATACATCCTGTTGG - Intergenic
938038346 2:128054884-128054906 AGGCATTTTCTGCATCCTGCTGG - Intergenic
939362693 2:141194160-141194182 AAACAGTTTTGCCATCCTGCTGG + Intronic
939918335 2:148076482-148076504 AATCATTTCTTTCATCATGCTGG + Intronic
940346524 2:152634572-152634594 AAGCATTTTCCGCATCCTGCTGG + Intronic
941251749 2:163173597-163173619 AAGCAAGTTTTGCAGCATGCAGG - Intergenic
941392734 2:164935039-164935061 AAGCATATTTTTCTTCCTCCAGG + Intronic
942325336 2:174771741-174771763 AACCATTTGTTGCCACCTGCTGG - Intergenic
943932738 2:193875963-193875985 AAGCATTTTCTACATCCTGCTGG + Intergenic
944361687 2:198864611-198864633 AAGCATTTTCTGCATCCTGCTGG - Intergenic
944550836 2:200843368-200843390 AAGCATTTTCTGTGTCCTGCTGG + Intergenic
944946355 2:204690847-204690869 AAGCATTTATCTCATCCTGCAGG - Intronic
945363075 2:208915425-208915447 AAGCATTTTCTGCATCTTGCTGG + Intergenic
945375984 2:209079522-209079544 AAGAATTATTTGGATCTTGCAGG - Intergenic
945503568 2:210609311-210609333 AATCATTTTCTGCATCCAGAAGG + Intronic
945821130 2:214666932-214666954 AATCATTTTCTGTATCCTGCTGG - Intergenic
947066259 2:226228921-226228943 AAGCATATACTGCATCCTGGAGG - Intergenic
1169088483 20:2841568-2841590 AAGAATTTTGCGCATCCTTCAGG + Intronic
1169526077 20:6427272-6427294 AAGCATTTTCTGCATTTTGCTGG + Intergenic
1169882652 20:10364327-10364349 AAGCATGTTCTGCATCCTGCTGG - Intergenic
1170222879 20:13959673-13959695 AAGCATTTTCTGAATCTTGCTGG - Intronic
1170417645 20:16161416-16161438 ATGGATGTTTTGCATCCTGGGGG - Intergenic
1173758196 20:45536928-45536950 AAGCATTTGTTGCATCCCTATGG - Intronic
1175436045 20:58949423-58949445 AAGCATTTTCTGCATGCTGCTGG - Intergenic
1175709014 20:61204349-61204371 AATCATTTTCAGCATCATGCTGG - Intergenic
1176227072 20:64006792-64006814 CAGCATTTGTGGCATCCTACTGG + Intronic
1176788109 21:13283950-13283972 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1177072325 21:16526214-16526236 AAGCACTTTCTGCATCCTGCTGG + Intergenic
1177361597 21:20079075-20079097 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1177987251 21:27992154-27992176 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1178853902 21:36235249-36235271 CAGCCTTTTTTTAATCCTGCGGG + Intronic
1179214726 21:39357639-39357661 AAGCATTTTCTGCATTTTGCTGG + Intergenic
1181160350 22:20956551-20956573 AAGCATTCTTGGCTTCCTGGAGG + Intergenic
1181437696 22:22920055-22920077 AAGAATTTTGTTCATCTTGCAGG - Intergenic
1182381705 22:29895441-29895463 AAGCATTTTCTGCATCCTGCTGG + Intronic
949463261 3:4317114-4317136 AAGCATTTTCTGCATCCTGCTGG - Exonic
949694095 3:6674224-6674246 AAACATTTTCTGCATGCTGCTGG - Intergenic
949975908 3:9459052-9459074 AAATATTTTCTGCATCCTGCTGG + Intronic
952382096 3:32813364-32813386 AATCATTGCCTGCATCCTGCCGG - Intergenic
952985808 3:38781604-38781626 AGGCATTTTCTGCATCCCGCTGG - Intronic
954941734 3:54379231-54379253 AAGCAATTTTTGCAGCTTTCAGG + Intronic
955359518 3:58260983-58261005 AAGCATTTGGTACCTCCTGCAGG - Intronic
956346605 3:68286538-68286560 AATCCTTCTTTGCATCCTCCGGG - Intronic
956662032 3:71608533-71608555 TAGCACTTTTTCCATCCTTCTGG + Intergenic
957200542 3:77129478-77129500 AAGCATTTTCTGCATTCTGCAGG + Intronic
957577381 3:82026949-82026971 AAGCATTTTCGGCATCCTGCTGG + Intergenic
957681298 3:83439649-83439671 AACCCTTTTTTGAATTCTGCTGG - Intergenic
958491103 3:94774645-94774667 AAACATTTTCTGTATCCTGCTGG - Intergenic
958572729 3:95909529-95909551 AAGCATTTTCTGTATCCTGTTGG - Intergenic
958854647 3:99370076-99370098 AAGCATTTTCTGCATGCTGCTGG + Intergenic
959201227 3:103250411-103250433 AAGCATTTTCTGCATTCTGCTGG + Intergenic
959908985 3:111741815-111741837 AAGAATTTTTTACATGCTGAAGG - Intronic
960740011 3:120822804-120822826 AAACATTCTTAGCATCCTTCTGG - Intergenic
960901721 3:122560819-122560841 ATGCATTTTTTGCCTCCAGAGGG + Intronic
961701416 3:128747728-128747750 AAGAATCCTTTGCTTCCTGCAGG - Intronic
961808781 3:129508702-129508724 AAGCATTTTCTGCATCCTGCTGG + Intronic
962047565 3:131776740-131776762 AAACATTTATTGCATCTTGTTGG + Intronic
963350547 3:144146219-144146241 AAGCATTTTCTGCATCCTGCTGG + Intergenic
963680387 3:148367623-148367645 AATCAATTATTTCATCCTGCTGG - Intergenic
964074687 3:152679292-152679314 AAGCATTTTCTGCATCCTGCTGG - Intergenic
964196084 3:154066452-154066474 AAGCATTTTCTGCATCCTGCTGG + Intergenic
964907519 3:161735913-161735935 AACCATTTTCTGTATCCTGCTGG - Intergenic
965132266 3:164715954-164715976 AAGCTTTCTTTGAATTCTGCAGG + Intergenic
966112256 3:176417201-176417223 AAGCATTTTCTGCATCCTACTGG + Intergenic
966235632 3:177698791-177698813 AAGCATTTTCTGCATCCTGCTGG + Intergenic
969071464 4:4542442-4542464 CAGCATTTATTGCATCCCGAGGG - Intergenic
969985729 4:11208535-11208557 CATCATTTTATGGATCCTGCTGG + Intergenic
970266402 4:14292593-14292615 AAGCATTATTTGCATATAGCAGG + Intergenic
970285818 4:14513324-14513346 AAGCATTTTCTGCACCCTGCTGG - Intergenic
971675489 4:29621789-29621811 AAGCATTTTGTGCATCTTGCTGG - Intergenic
972064673 4:34926203-34926225 AAGCATTCTGTACATCTTGCTGG + Intergenic
972226847 4:37023330-37023352 AAGCATTTTCTGCATCCTGCTGG - Intergenic
972454029 4:39234565-39234587 AATCAATTTTTGCCTCCTTCAGG + Intronic
972589435 4:40470430-40470452 AAGCATTTATTGGATGCTTCTGG + Intronic
972803167 4:42499069-42499091 AAGTAGTGTTTGGATCCTGCAGG - Intronic
973059009 4:45695860-45695882 GAGCATTTTCTGCATCCTGCTGG - Intergenic
973840655 4:54857094-54857116 AAGCTTTTTCTGCCTCCTCCAGG - Intergenic
973919349 4:55669021-55669043 AAGCATTTTTAGCAGCCCTCTGG - Intergenic
974248473 4:59354496-59354518 AAGCATTTTCTGCATCCTGGTGG - Intergenic
975511325 4:75196372-75196394 AAGCATTTTCTGCATCCTGCTGG + Intergenic
976060369 4:81121057-81121079 ATGCTTTTTTTTCAGCCTGCTGG + Intronic
977537531 4:98272350-98272372 AAGCATTTTCTGCATCCTGCTGG + Intronic
977714595 4:100167657-100167679 CAGCATTTAATGCCTCCTGCTGG + Intergenic
978075071 4:104518537-104518559 AAGAATTTTCTGCATCCTGCTGG + Intergenic
978595282 4:110370830-110370852 AAGCATTTTTTGCATCCTGCTGG - Intronic
978714609 4:111826293-111826315 AAGCATTTTCTGCATCCTGCTGG + Intergenic
979809268 4:125014935-125014957 AAGCATTTTCTGCATTCTGCTGG + Intergenic
980248752 4:130284827-130284849 AAGCATTTTCTGCATCCTGGTGG - Intergenic
980314090 4:131173931-131173953 AAGCATACTGTGCATCCTGTTGG + Intergenic
980764871 4:137288733-137288755 AAGCATTTTCTGCATCCTGCTGG - Intergenic
981075836 4:140590696-140590718 AAGCATTTTCTGCATCCTGCTGG - Intergenic
981191062 4:141863786-141863808 AAGCATTTTCTGCACCCTACTGG - Intergenic
981285394 4:143012170-143012192 AGGCATATTCTGCATCTTGCTGG + Intergenic
981314638 4:143330177-143330199 AAGCATTTTCTGCCTCCTGCTGG - Intergenic
982648729 4:158058889-158058911 AATCTCTTTTTGCATCCTTCGGG - Intergenic
984089824 4:175358983-175359005 AAGCATTTTCAGCATTCTGCTGG - Intergenic
986071652 5:4290872-4290894 ATGCATTTTTTGTAGCCTCCAGG - Intergenic
986460377 5:7964283-7964305 AAGCATTTTCTGCATCCTGCTGG + Intergenic
988156902 5:27465155-27465177 AAGCATTTTCTACATTCTGCTGG + Intergenic
988658177 5:33235359-33235381 GAGCATATTTTGCATTCTGAAGG + Intergenic
989588300 5:43090162-43090184 AAGCATTTTTTGTATCTAGAAGG + Intronic
990232180 5:53725240-53725262 AAGCATTTTCTGCTTCCTGCTGG - Intergenic
990769910 5:59231451-59231473 CAGCATCTTTAGCATCCAGCTGG - Intronic
991514974 5:67425215-67425237 GAGCATTTTTTTCATCTTCCTGG - Intergenic
992307321 5:75455331-75455353 AAGCATTTTCTGCATCCTGCTGG - Intronic
993695419 5:91055981-91056003 AAGCATTTTCTGCATCCTGCTGG + Intronic
994432627 5:99687342-99687364 AGGTATTTTCTGCAACCTGCTGG - Intergenic
995205873 5:109480921-109480943 AAGCATTATTTCCATCCTGAAGG - Intergenic
995380440 5:111525944-111525966 AAGCATTTTCTGCATCCTGCTGG + Intergenic
997908514 5:137844673-137844695 AAGTATTTTCTGCATTCAGCAGG + Intergenic
998323280 5:141253521-141253543 GACCATTTTTTCTATCCTGCTGG + Intergenic
999863368 5:155673630-155673652 AAATATTTTCTGCATCCTGCTGG + Intergenic
999964407 5:156793315-156793337 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1000263419 5:159612036-159612058 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1000436268 5:161213644-161213666 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1000701091 5:164451453-164451475 AAGCATGTTCGCCATCCTGCTGG + Intergenic
1001090067 5:168733023-168733045 AAGTATTTTTCCCATCCTGCAGG - Intronic
1002144557 5:177168818-177168840 AAGCATTTTCTGCATCCTGCTGG + Intronic
1003419559 6:5944349-5944371 AAGCATTTTCTACCTTCTGCTGG + Intergenic
1003975114 6:11335638-11335660 AAGCATTTTCTGCACACTGCTGG - Intronic
1004424844 6:15500329-15500351 AAGTCTATTTTCCATCCTGCTGG - Intronic
1004432658 6:15559886-15559908 AAACATTTTCTGCATCCTCCTGG - Intronic
1004964365 6:20831240-20831262 AAACATTTTCTGCATCCTGCTGG + Intronic
1005526951 6:26660143-26660165 AAGCATTTCTTCCATCTCGCTGG - Intergenic
1006710429 6:36064327-36064349 AAGAATTTTTTGATTCCTCCTGG + Intronic
1008073599 6:47122246-47122268 AAGCGTTTTCTGCATCCTGCTGG + Intergenic
1008345724 6:50424140-50424162 AAGCATTTTTTCCATTCTGTGGG - Intergenic
1008539014 6:52530287-52530309 ATGCATCTTATGCATCCTGGTGG - Intronic
1008875572 6:56322429-56322451 AAGCATTTTCTGCATTCTCCTGG - Intronic
1008967219 6:57325009-57325031 AATCATATTTTGCATCCAGTAGG + Intronic
1010398716 6:75423812-75423834 AAGCATTTTCTGGATCCTGCTGG - Intronic
1010580254 6:77587727-77587749 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1012842503 6:104346988-104347010 AAGCATTTCCTGCATCCTGCTGG - Intergenic
1012868523 6:104645960-104645982 AAACCTTTCTTGCACCCTGCAGG + Intergenic
1013572183 6:111440015-111440037 AAGCATTTTCTGCATCCTATGGG - Intronic
1014527708 6:122520875-122520897 GAGCATTTTCTGCATCCTACTGG + Intronic
1014792408 6:125688799-125688821 AAGCATTTTCTACATCCAGCTGG + Intergenic
1014864936 6:126517552-126517574 GAGCATTTTCTTCATCCTGCTGG + Intergenic
1014982280 6:127958856-127958878 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1015412059 6:132904632-132904654 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1016222049 6:141686229-141686251 AAGCATTTTCTGCATGCTGCTGG + Intergenic
1016853812 6:148646263-148646285 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1017144459 6:151221725-151221747 AAGCATTTTCTGAACCCCGCTGG - Intergenic
1017900459 6:158715020-158715042 AATCACTGTTTCCATCCTGCTGG + Intronic
1017903754 6:158740927-158740949 AAGCATTTTCTGCATCCTTCTGG + Intronic
1017972296 6:159323375-159323397 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1018569982 6:165199455-165199477 AGGCATCTTTTGTATCCTGCTGG - Intergenic
1020651059 7:10876920-10876942 AAACATTTTTTCCATCCTGTGGG + Intergenic
1020676894 7:11193636-11193658 CAGCATGTTTTACATCCTGGGGG + Intergenic
1021135239 7:16957477-16957499 AAGCATTTTCTGCATCTTGCTGG - Intergenic
1021970912 7:25965179-25965201 AAGCATTTCTTGCCTCCAGCTGG - Intergenic
1022577355 7:31510804-31510826 AGGCATTTTCTGCATCTTTCTGG - Intergenic
1022843295 7:34185246-34185268 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1024279118 7:47704031-47704053 AAGCATTTTCTGCATCCTGCTGG + Intronic
1024383808 7:48728108-48728130 AAGCATTTTCTGCATTCTATTGG + Intergenic
1024413778 7:49079025-49079047 AAGCCTTTTTGGCTTCCTTCTGG - Intergenic
1024430120 7:49278747-49278769 AAGCATTTTCTGCATCCTGCCGG + Intergenic
1026240362 7:68568871-68568893 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1028748117 7:94350637-94350659 AGTCCATTTTTGCATCCTGCTGG + Intergenic
1028882422 7:95894759-95894781 AAGCATTTTCTGCATCCTGCTGG + Intronic
1029153452 7:98498210-98498232 AAGAATTGTTTGCACCCGGCAGG - Intergenic
1029726103 7:102405920-102405942 AAGCATTTTCTGCATCCCGCTGG + Intronic
1030380940 7:108811237-108811259 AAGCATTTTATGAAGCATGCAGG + Intergenic
1030495421 7:110293002-110293024 AAGCATTTTCTGCATCCTGATGG + Intergenic
1030594709 7:111524090-111524112 ATGCATCTTTTGCATCTTGAAGG - Intronic
1030763707 7:113382714-113382736 AAGCATTTTCTGCATTCTGCTGG - Intergenic
1030995370 7:116352954-116352976 AAGCATTTCTTAAAACCTGCTGG - Intronic
1031255733 7:119445770-119445792 AAGCATTTTTTGCTTCCTGCTGG - Intergenic
1031579904 7:123460193-123460215 AGGCATTATTTCCATTCTGCAGG - Intronic
1031649713 7:124273241-124273263 GAGCACTTTCTGCATCCTGCTGG + Intergenic
1032198541 7:129803768-129803790 ATGCATTATTTGCACCCGGCTGG - Intergenic
1033574144 7:142663678-142663700 AAGCATTTTCTGCATCTTGCTGG - Intergenic
1033963682 7:146946782-146946804 AAGCATTTTCTACATCTTGCTGG + Intronic
1034560914 7:151878465-151878487 AAGGATTTTGTGCAAGCTGCTGG - Intergenic
1035554090 8:552415-552437 AAGCATTTTCTGCATCCTGCGGG - Intergenic
1036009602 8:4707378-4707400 AAGCATGTTTTTAATCGTGCTGG + Intronic
1036113197 8:5929262-5929284 AGTTATTTTTTGCCTCCTGCTGG - Intergenic
1036226455 8:6962538-6962560 AAACATTTTCTGCATCCCGCTGG - Intergenic
1037040027 8:14219880-14219902 AAGCATTTTCTGCATCCTACTGG - Intronic
1038352817 8:26795653-26795675 AAACATTTTTTACCTCCTGATGG + Intronic
1038490069 8:27964538-27964560 AAGCCTTTTTTTCATCATACTGG + Intronic
1038902470 8:31858949-31858971 AAGTATTTCCTGCATCCTGCTGG - Intronic
1038982017 8:32770123-32770145 TAGCCTTTTTGGCATCCTGTGGG - Intergenic
1039753767 8:40500596-40500618 AGGCAAGGTTTGCATCCTGCTGG + Intergenic
1039924013 8:41912678-41912700 AAGCATTTTCTGCCTCCTGCTGG + Intergenic
1040129404 8:43777048-43777070 AACCATTTTTTTTATCCAGCAGG + Intergenic
1040344285 8:46472524-46472546 AAACTTTTTTTGCATTCAGCAGG - Intergenic
1040346160 8:46498313-46498335 AACCTTTTTTTACATTCTGCAGG - Intergenic
1040347667 8:46524053-46524075 AACCATTTTTTACATACAGCAGG + Intergenic
1040757800 8:50801870-50801892 AAAACTTTTCTGCATCCTGCTGG - Intergenic
1040778738 8:51080172-51080194 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1041069724 8:54115563-54115585 AAGCATTTTCTGCATGCTGCTGG + Intergenic
1041213123 8:55572656-55572678 AAGCATTTTCTACATCCTGCAGG + Intergenic
1041219502 8:55634566-55634588 AAGCATTTTCTTCATCCTGCTGG + Intergenic
1041448034 8:57975197-57975219 GAGCATATATTGCATCCTGGAGG + Intergenic
1042098431 8:65245566-65245588 AAGCATTTTCCGCATCCCGCTGG - Intergenic
1042251753 8:66762960-66762982 AAACATTTTATGCCTCCTGATGG - Intronic
1042513611 8:69636583-69636605 AAGCATTTTCTACGTTCTGCTGG + Intronic
1043330437 8:79110720-79110742 AAGCATTTTCTCCATCCTGCTGG + Intergenic
1043367051 8:79544678-79544700 AGGCATTTTCTAGATCCTGCAGG - Intergenic
1043686407 8:83092351-83092373 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1044438465 8:92194053-92194075 AAGCATTTTCTGCATTATGCTGG + Intergenic
1045888367 8:107126184-107126206 AAGCATTTTCTATATCCTGCTGG - Intergenic
1046030818 8:108781850-108781872 AAGCATTTAATGAATCTTGCAGG - Intronic
1046510617 8:115197671-115197693 CAGCATTTTCCGTATCCTGCTGG - Intergenic
1047599867 8:126415269-126415291 AAGCATTTTCTGCGTCCTGTTGG + Intergenic
1047659814 8:127020862-127020884 AAGCGTGTTCTGCATCCTGCTGG - Intergenic
1048099811 8:131338699-131338721 AAACATTTTCTGCATCCTGATGG - Intergenic
1048413974 8:134205834-134205856 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1050462553 9:5889357-5889379 AAGCATTTTCTGCATCCTGCTGG - Intronic
1050743789 9:8853996-8854018 AAGCATTTTTTGAATACTCTGGG + Intronic
1051042560 9:12830230-12830252 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1051119712 9:13738697-13738719 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1051142670 9:13994693-13994715 AAGCATTTTTTGCATCCTGCTGG + Intergenic
1051573845 9:18591827-18591849 AAGCATTTTCTGCATCCTGCTGG + Intronic
1051965338 9:22821638-22821660 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1052139933 9:24968392-24968414 AAGCGTTTTCTGCATCCTGCTGG + Intergenic
1052886598 9:33655118-33655140 AAGTATTTTCTGCATCTTGTTGG - Intergenic
1052957069 9:34261209-34261231 AAGATTTTTTTGTATGCTGCAGG - Intronic
1053228685 9:36385971-36385993 AAGTATTTTCTGCATCCTGCTGG - Intronic
1055167116 9:73210428-73210450 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1055198241 9:73623694-73623716 AAACATTTTTTGCACCCTGCTGG - Intergenic
1055979068 9:81983736-81983758 AAGCATTTTAAGCAGCCTGTGGG - Intergenic
1056144224 9:83713397-83713419 AAGCATGTTCTGCATCCTGCTGG - Intergenic
1056173420 9:84010550-84010572 AGGAATTTTCTGCATCCTGCTGG + Intergenic
1056893145 9:90514909-90514931 CAGCTTTTTCTGCATGCTGCAGG + Intergenic
1056941041 9:90956527-90956549 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1057766999 9:97930050-97930072 AAGCATCTTTAGCATCTTCCTGG + Exonic
1058311612 9:103510579-103510601 AAGCATTTTCAGCATCCTGCTGG - Intergenic
1059026168 9:110633562-110633584 AAGGAATTTCTGCATCCTGCTGG - Intergenic
1060102305 9:120851347-120851369 AAGCTTTTTGTGCATGCTGCTGG + Intergenic
1061174516 9:128985713-128985735 AAGCATTCATTGATTCCTGCAGG - Intronic
1062719614 9:138031504-138031526 AAGCATTGTTTAGATCCTGTTGG + Intronic
1185667685 X:1780072-1780094 AAGCATTTTTTGCTTTCAGATGG + Intergenic
1186533748 X:10326188-10326210 AAGCAGCTTTGCCATCCTGCTGG - Intergenic
1187555675 X:20349030-20349052 CAGCATTCTTTGCATTCAGCTGG + Intergenic
1188055280 X:25533734-25533756 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1188177476 X:27009662-27009684 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1188294114 X:28425047-28425069 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1188471295 X:30542592-30542614 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1189416568 X:40820101-40820123 AAGTATTTTCTGCATCCTGCTGG - Intergenic
1190806548 X:53843423-53843445 GTGCATTTATTACATCCTGCGGG + Intergenic
1191008939 X:55740506-55740528 AAGAATTTTCTGCATCCTGCTGG + Intronic
1191614693 X:63156578-63156600 AAGCATTTCTCCCATCCTGTAGG - Intergenic
1191621603 X:63222349-63222371 AAGCATTTCTCCCATCCTGTAGG + Intergenic
1192111725 X:68371832-68371854 AAGAATTCTTTGAATCCTGGAGG - Intronic
1192274380 X:69615329-69615351 CAGCATTTTTTGCATTGTACAGG + Intergenic
1193829962 X:86278418-86278440 AAGCACTTTCTGCATCCTGCTGG - Intronic
1193867052 X:86745995-86746017 GAACATTTTTTACATGCTGCTGG + Intronic
1193966528 X:87993830-87993852 AAATATTTTCTCCATCCTGCGGG + Intergenic
1194334909 X:92633593-92633615 AGGCATTTTCTGCATCTTGCTGG + Intergenic
1194388714 X:93289426-93289448 AAGCATTGTCTGCATCCTGCTGG + Intergenic
1194528900 X:95018986-95019008 AAGCATTTTCTGCATCCTGATGG + Intergenic
1194933223 X:99915028-99915050 AAGCATGTTTTATATCATGCTGG - Intergenic
1195527791 X:105912089-105912111 ATGCATTTTTTGTTTCCTGCTGG - Intronic
1195767776 X:108314934-108314956 CAGCATTTTTTGCAACATTCTGG + Intronic
1196515221 X:116603183-116603205 AAGCATTTTCTGCATCCTGCTGG + Intergenic
1197015232 X:121617154-121617176 AAGCATTTTCTACATGCTGCTGG + Intergenic
1197361361 X:125507561-125507583 AATAATTTTCTGCATCCTGCTGG + Intergenic
1197827435 X:130605290-130605312 AAGCCTTTATTGTCTCCTGCTGG + Intergenic
1198317267 X:135480669-135480691 AAGTATTTTCTGCCTCCTGCTGG + Intergenic
1198844297 X:140893507-140893529 AAGCATTTTCTGCATCCTGCTGG - Intergenic
1200611266 Y:5329029-5329051 AAGAATTATTTGGATCTTGCAGG + Intronic
1200628901 Y:5556313-5556335 GAGCATTTTTTGCAACCCACTGG + Intronic
1200643387 Y:5750644-5750666 AGGCATTTTCTGCATCTTGCTGG + Intergenic
1201501473 Y:14647933-14647955 ACTGATTTCTTGCATCCTGCTGG + Intronic
1202030394 Y:20566841-20566863 AAGCATTTTCTTCATTTTGCTGG - Intergenic