ID: 1051145861

View in Genome Browser
Species Human (GRCh38)
Location 9:14026715-14026737
Sequence CTCAAATACTAGTTGTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051145860_1051145861 -9 Left 1051145860 9:14026701-14026723 CCAAAGGACTGGAACTCAAATAC No data
Right 1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051145861 Original CRISPR CTCAAATACTAGTTGTGCCA TGG Intergenic
No off target data available for this crispr