ID: 1051146384

View in Genome Browser
Species Human (GRCh38)
Location 9:14032013-14032035
Sequence CTCTTACATCAGTGGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051146376_1051146384 24 Left 1051146376 9:14031966-14031988 CCAAGCCCAGCCAGCCTAACAGT No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146381_1051146384 1 Left 1051146381 9:14031989-14032011 CCTTCAGTATCTTCATTTCTGCC No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146380_1051146384 10 Left 1051146380 9:14031980-14032002 CCTAACAGTCCTTCAGTATCTTC No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146379_1051146384 14 Left 1051146379 9:14031976-14031998 CCAGCCTAACAGTCCTTCAGTAT No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146377_1051146384 19 Left 1051146377 9:14031971-14031993 CCCAGCCAGCCTAACAGTCCTTC No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146374_1051146384 29 Left 1051146374 9:14031961-14031983 CCTGCCCAAGCCCAGCCAGCCTA No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146378_1051146384 18 Left 1051146378 9:14031972-14031994 CCAGCCAGCCTAACAGTCCTTCA No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data
1051146375_1051146384 25 Left 1051146375 9:14031965-14031987 CCCAAGCCCAGCCAGCCTAACAG No data
Right 1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051146384 Original CRISPR CTCTTACATCAGTGGTTCTC AGG Intergenic
No off target data available for this crispr