ID: 1051151707

View in Genome Browser
Species Human (GRCh38)
Location 9:14086922-14086944
Sequence TGACAGATCCATAGTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051151707_1051151708 1 Left 1051151707 9:14086922-14086944 CCATGCACACTATGGATCTGTCA 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1051151708 9:14086946-14086968 TACAAGAAATTTGTTGAACAAGG 0: 1
1: 0
2: 1
3: 66
4: 1313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051151707 Original CRISPR TGACAGATCCATAGTGTGCA TGG (reversed) Intronic
901275758 1:7989858-7989880 TGACAGACTCCTTGTGTGCATGG - Intergenic
905895454 1:41543072-41543094 TTACAGATCTATAGTGCGCATGG - Intronic
905909408 1:41643583-41643605 TGACAGATACACAGTCTGCCTGG + Intronic
910216024 1:84845484-84845506 TGACAGATTTATAGTTTACAGGG - Intronic
911746501 1:101447035-101447057 TGTCAGATGCATGGTTTGCAAGG + Intergenic
912045130 1:105444273-105444295 TGACAGAAACATAGTGTGCAAGG - Intergenic
913157629 1:116115567-116115589 TGACATACACATAGTCTGCATGG + Intronic
916393680 1:164361499-164361521 TCACAGATTCTTAGTGAGCATGG + Intergenic
920986800 1:210898276-210898298 TGACAGATCCCCAGTGTGGTGGG - Intronic
922691102 1:227692340-227692362 TGAGAAATCCTCAGTGTGCAGGG - Intergenic
922882313 1:228990164-228990186 TGACTGATCAAGAGTGTCCATGG - Intergenic
1063473272 10:6306284-6306306 TGATAGATGCATAGGGTTCAGGG - Intergenic
1064930242 10:20617436-20617458 TCACAACTCCACAGTGTGCAAGG + Intergenic
1066687440 10:37994199-37994221 TGACAGGTCCAGAGTCTGAAAGG - Intergenic
1068190140 10:53641134-53641156 TGTCAGATACATATTTTGCAAGG - Intergenic
1071398061 10:85242547-85242569 TGACAGATAGATAGAGTCCAGGG - Intergenic
1072248028 10:93560185-93560207 TGGCTGATCCATCGAGTGCAGGG + Intergenic
1074534512 10:114319326-114319348 TAAAAGACCCACAGTGTGCATGG - Intronic
1074565594 10:114574797-114574819 TGACAGATACATAGAGAACAGGG + Intronic
1074675653 10:115847714-115847736 GTGCACATCCATAGTGTGCAAGG + Intronic
1075407615 10:122205006-122205028 TGACAGAGCCATAGTGAGGATGG - Intronic
1077816223 11:5688168-5688190 TGGCAAATCCAAAGTCTGCAAGG + Intronic
1077984389 11:7336246-7336268 TGTTAGATGCATAGTTTGCAAGG + Intronic
1080442450 11:32307465-32307487 TGACAGATCAAATGTGTGGAAGG - Intergenic
1080478273 11:32619086-32619108 TGTCAGATACATTGTTTGCATGG + Intronic
1082999814 11:59280972-59280994 TGGCAGAAGCATTGTGTGCAAGG - Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085505661 11:77057267-77057289 TGCCTGATCCATCGAGTGCAGGG + Intergenic
1085616048 11:77999673-77999695 TTACAGATCTATTGTGTGCATGG - Intergenic
1085897895 11:80661702-80661724 TGACAGATCCATCTTGTCCCTGG - Intergenic
1087848741 11:103003883-103003905 TGTCAGATGCATAGTTTGCAAGG - Intergenic
1090753863 11:129771514-129771536 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1090959114 11:131540012-131540034 TGACAGGACCGTAGTGAGCAAGG - Intronic
1095639888 12:44475791-44475813 TGACATTTACCTAGTGTGCAGGG - Intergenic
1096353572 12:50919993-50920015 TGACATCTACATAGCGTGCAGGG - Intergenic
1098524690 12:71473188-71473210 TGCCAGATCCATGATGTGCTGGG - Intronic
1099459868 12:82909262-82909284 TGACAGATCTAGTGTATGCAAGG + Intronic
1103344692 12:120241507-120241529 TCACAAACACATAGTGTGCACGG + Intronic
1103473810 12:121203562-121203584 TGACATAACCATCGTATGCATGG - Intergenic
1105612083 13:21977548-21977570 TGACAGTTCAATACTGTGGAGGG + Intergenic
1109312002 13:60706374-60706396 AAACATCTCCATAGTGTGCATGG + Intergenic
1109933174 13:69244092-69244114 TGGCAGAAGCATTGTGTGCAAGG + Intergenic
1111058274 13:82978744-82978766 TGACAGGTTCATAGTGTGAATGG - Intergenic
1111808769 13:93071313-93071335 TGTCAGATACATAGTTTGGAAGG - Intergenic
1112085780 13:96031046-96031068 TGACAGATCCTTAATACGCAAGG - Intronic
1113922291 13:113919868-113919890 TGCCAGATCCTGAGTGTGCCGGG + Intergenic
1115041514 14:28935918-28935940 TGACAGATCTCTAGTGTTTAGGG + Intergenic
1115364798 14:32545949-32545971 TGACAGATCCAAACTTTGCCTGG + Exonic
1115436147 14:33376666-33376688 TGACAGATTCATTATGTGCGTGG + Intronic
1118068955 14:62224091-62224113 AGACAGAACCCTAGTCTGCACGG - Intergenic
1118948000 14:70406640-70406662 TGCCTGATCCATTGAGTGCAGGG - Intronic
1119401285 14:74364333-74364355 TGCCAGATCCCTTGTGAGCAGGG - Intergenic
1121070615 14:91017320-91017342 TGACAGAAATATTGTGTGCAGGG - Intronic
1124008380 15:25812751-25812773 TCAGAGATCAATAGTGTGCTTGG - Intronic
1124647521 15:31449389-31449411 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1128077597 15:64837641-64837663 TGACAGAAGCTTAGTGAGCAAGG - Intergenic
1133003733 16:2865649-2865671 TACCAGATCCACAGTTTGCAGGG + Intergenic
1134162172 16:11900412-11900434 TCACAAATCCATATTGTGTAGGG + Intronic
1137479981 16:48844295-48844317 TAACTGATCCTTAGTATGCAGGG - Intergenic
1137504977 16:49046592-49046614 TGACAGATCTAAACTCTGCAGGG + Intergenic
1138374797 16:56555498-56555520 TGCCAGTTACATAGTGTGCTAGG - Intergenic
1138524019 16:57591415-57591437 TGCCACATCTATAGTGTGCTAGG - Intronic
1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG + Intronic
1141983485 16:87564740-87564762 TGACAAGTCCACAGTCTGCAGGG + Intergenic
1143428239 17:6857748-6857770 TGCCAGATGCATAGTTTGCTAGG + Intergenic
1144442705 17:15298150-15298172 TAACAACTCCATAGTGTCCATGG + Intergenic
1150686119 17:67322281-67322303 TGACATTTACATAGTGTGCTGGG - Intergenic
1153838392 18:8984589-8984611 TGACTGATAAATTGTGTGCAGGG + Intergenic
1154332407 18:13440826-13440848 TGTCAGAGCCATTGTGTACACGG + Intronic
1154917251 18:20747339-20747361 AGACAGATCCATGGTGTATATGG + Intergenic
1155778975 18:29806568-29806590 TAACAATACCATAGTGTGCAGGG + Intergenic
1156565253 18:38181529-38181551 GGACAGCTACAGAGTGTGCATGG + Intergenic
1156942464 18:42785784-42785806 TGAAAGATGCAAAGTGTGCTGGG - Intronic
1158066020 18:53409215-53409237 TGAGATGTACATAGTGTGCATGG + Intronic
1158701467 18:59752112-59752134 TGACAAATCCACAATCTGCAGGG - Intergenic
1160288223 18:77566834-77566856 TGAGAGATCCCTGGTGTGGAGGG + Intergenic
1161830804 19:6602782-6602804 TGACGTCTACATAGTGTGCAGGG - Intronic
1163126355 19:15246332-15246354 TCCCAGTTCCCTAGTGTGCAGGG - Intronic
926358149 2:12060057-12060079 TGAAAGATCCTTAAAGTGCAGGG - Intergenic
930491210 2:52075072-52075094 TGACAGAAACATAGTGTGTTGGG - Intergenic
931933844 2:67172919-67172941 TGACAGTTCCACAGTGTGAGTGG - Intergenic
935364492 2:102275169-102275191 TGACATTTACATAATGTGCAGGG - Intergenic
939071826 2:137553339-137553361 TGTCAGAGCCATAGGGTTCAAGG - Intronic
941623350 2:167803793-167803815 TGACAGAACGAGAGTGTGAATGG - Intergenic
942937983 2:181581603-181581625 TGACAGAAACATGGTGGGCAGGG + Intronic
943553729 2:189374845-189374867 AAAGAGATCCATAGTGTGAAAGG - Intergenic
944959498 2:204855046-204855068 TGACATTTACATAGCGTGCAAGG + Intronic
946487866 2:220118044-220118066 TGACAGATTCAGAGTGAGGAAGG - Intergenic
946495459 2:220191919-220191941 TGCCAGCTCCATGGAGTGCACGG - Intergenic
1169466146 20:5841367-5841389 TGAAAGATTTATTGTGTGCATGG + Intronic
1169677393 20:8169315-8169337 TCAGAGATACATAGTGTTCAAGG - Intronic
1179201216 21:39223098-39223120 TGACAAATCCAAAATGTGAAAGG + Intronic
1179310677 21:40193262-40193284 TGGCAGATCCATGGTGAGCCTGG - Intronic
1181784056 22:25213367-25213389 TGACAGATACATAGAGAGAAAGG - Intergenic
1182786197 22:32909727-32909749 TGACAGGTTCATAGTGTTAATGG - Intronic
953197824 3:40750619-40750641 TGACAGTCCCAAAGTGGGCAGGG + Intergenic
954811987 3:53254382-53254404 TAACAGGTCCAAAGTGTGCAAGG + Intronic
961481721 3:127184683-127184705 TGACAGATCCAGACGGTGCGGGG - Intergenic
963661543 3:148133237-148133259 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
968083628 3:195863968-195863990 GGACTGAACCAAAGTGTGCAGGG + Exonic
970054558 4:11956315-11956337 TGAGTGATCCCTAGTATGCAAGG + Intergenic
971662908 4:29443100-29443122 TGGCAAATCCAAAATGTGCATGG - Intergenic
971845866 4:31916953-31916975 TTACAGGTTCATAGTGTGAAGGG + Intergenic
972585441 4:40433303-40433325 TGAGAGAACAATAGTGAGCATGG - Intronic
974434089 4:61834635-61834657 TGACAGGGCCATAGTGAGAATGG + Intronic
978087109 4:104667805-104667827 TGACAGTTGCATTGTGTGCCTGG - Intergenic
981605762 4:146538304-146538326 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
981702017 4:147617557-147617579 AGACAGAACCGGAGTGTGCAGGG + Exonic
983396113 4:167197857-167197879 GGACAGATCCAAACTGTGTAAGG + Intronic
986261481 5:6151424-6151446 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
987049156 5:14135171-14135193 TGGCAAATCAACAGTGTGCAAGG + Intergenic
987646259 5:20676195-20676217 TGGCAGAACCATAGCATGCACGG + Intergenic
989527105 5:42466205-42466227 TGACCATTCCCTAGTGTGCATGG - Intronic
995280483 5:110330370-110330392 AGCCAGATCCTTAGTGTGTATGG + Intronic
996381577 5:122867326-122867348 TGGCAGAAGCATTGTGTGCAGGG + Intronic
998623784 5:143823152-143823174 TCACAGATGCATAGAGTCCAAGG + Intergenic
999576840 5:152988297-152988319 TGACTGAGGCAGAGTGTGCAGGG + Intergenic
999798507 5:155010563-155010585 TGACGGCTCCATAGTTTGTATGG + Intergenic
1000924221 5:167174062-167174084 AGACAGAGCTATGGTGTGCAAGG + Intergenic
1002340322 5:178512499-178512521 AGACAGATACAGAGTGTGCCAGG + Intronic
1004535454 6:16496452-16496474 GCACAGATCCATCGTGTGGAGGG + Intronic
1012338859 6:98093010-98093032 TGAAAGATCCATAGTCTGAAGGG + Intergenic
1012350101 6:98239884-98239906 TGAGAGAATAATAGTGTGCAAGG - Intergenic
1014224333 6:118830900-118830922 TGCCAGATCGTAAGTGTGCAAGG + Intronic
1014693077 6:124586136-124586158 ACACAGATCCATAGTTTCCAGGG - Intronic
1016665297 6:146632476-146632498 TAACAGATCCACAGTTTCCAGGG + Intronic
1016819324 6:148333096-148333118 TGACATACCTATAGTCTGCAGGG + Intronic
1019261790 7:86071-86093 TGACAACGCCACAGTGTGCAGGG + Intergenic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1026245215 7:68613556-68613578 TTACATAGCCATAGCGTGCAGGG - Intergenic
1027467880 7:78537751-78537773 TGTCAGATGTATAGTTTGCAAGG + Intronic
1029950297 7:104576918-104576940 TGACAGATTCATTGTGGACAAGG - Intronic
1032529225 7:132606237-132606259 TGAGAGTTCCATAGGGAGCATGG + Intronic
1035064050 7:156092419-156092441 TGACAGTTGCCTACTGTGCATGG - Intergenic
1035459054 7:159028299-159028321 TGACAGATGCCTGGTGAGCAGGG - Exonic
1038141206 8:24847361-24847383 TGACAGATTCATTGTCTGCTGGG - Intergenic
1040852782 8:51919163-51919185 TGACACATCCCTAATCTGCAAGG - Intergenic
1041183807 8:55276925-55276947 TGACACAACCACAGTTTGCATGG - Intronic
1041544461 8:59026199-59026221 GGACAGATCCAAAGTGTACACGG - Intronic
1042787976 8:72571088-72571110 TGCCAGATCCCTAGTATGGAAGG + Intronic
1046315865 8:112500931-112500953 TGACATTTACATAGTGTGCGGGG - Intronic
1046397168 8:113655825-113655847 TGACATATCCTTAGGGTGTAAGG + Intergenic
1051151707 9:14086922-14086944 TGACAGATCCATAGTGTGCATGG - Intronic
1052895357 9:33742540-33742562 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1056473780 9:86932256-86932278 TGATGGATCCATAGTGTGACAGG + Intergenic
1058857216 9:109074610-109074632 TGAAAGTTCCATAGTATGCCAGG + Intronic
1062248722 9:135583742-135583764 TGTCAGGTTCATTGTGTGCACGG - Intergenic
1185721705 X:2387801-2387823 AGCCAGCTCCAGAGTGTGCATGG + Intronic
1187715160 X:22095463-22095485 TGACAAATCTATTGTGTGGAGGG + Intronic
1188757321 X:33978295-33978317 TGACAGATGCATGGAGTGGAAGG - Intergenic
1189358708 X:40331516-40331538 GAACAGATCCATAGTGTGGGTGG + Intergenic
1190183747 X:48217323-48217345 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190193399 X:48296131-48296153 GGACAGAATCAGAGTGTGCAAGG - Intergenic
1190223302 X:48527158-48527180 TGACAACTTCACAGTGTGCATGG + Exonic
1190663628 X:52677732-52677754 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190675795 X:52780690-52780712 GGACAGAATCAGAGTGTGCAGGG - Intronic
1191631421 X:63325958-63325980 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1192251595 X:69418250-69418272 TGAAAGATACATTGTGTTCATGG - Intergenic
1194482427 X:94442531-94442553 TGACATTTACATAGTGTGCTGGG + Intergenic
1194846243 X:98812775-98812797 TAATAGATCCATGGTGTGAAAGG + Intergenic
1196607346 X:117671720-117671742 TGACCCATCCTTAGTGGGCAGGG - Intergenic
1197587634 X:128368880-128368902 TGACAGAGTCATAATGTGGAAGG - Intergenic
1199021385 X:142882195-142882217 TGGCAGAAGCATTGTGTGCAGGG - Intergenic