ID: 1051155777

View in Genome Browser
Species Human (GRCh38)
Location 9:14143946-14143968
Sequence GTGCACATTACGAAGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051155775_1051155777 -7 Left 1051155775 9:14143930-14143952 CCCACAATGGCTTATTGTGCACA 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1051155777 9:14143946-14143968 GTGCACATTACGAAGTCTTCAGG No data
1051155776_1051155777 -8 Left 1051155776 9:14143931-14143953 CCACAATGGCTTATTGTGCACAT 0: 1
1: 0
2: 0
3: 15
4: 188
Right 1051155777 9:14143946-14143968 GTGCACATTACGAAGTCTTCAGG No data
1051155773_1051155777 24 Left 1051155773 9:14143899-14143921 CCGCATTTCTTCATTGTAGTTGA 0: 1
1: 0
2: 2
3: 29
4: 307
Right 1051155777 9:14143946-14143968 GTGCACATTACGAAGTCTTCAGG No data
1051155772_1051155777 25 Left 1051155772 9:14143898-14143920 CCCGCATTTCTTCATTGTAGTTG 0: 1
1: 0
2: 0
3: 17
4: 215
Right 1051155777 9:14143946-14143968 GTGCACATTACGAAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051155777 Original CRISPR GTGCACATTACGAAGTCTTC AGG Intronic
No off target data available for this crispr