ID: 1051156179

View in Genome Browser
Species Human (GRCh38)
Location 9:14148785-14148807
Sequence AGTATTAACGATGTAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051156178_1051156179 29 Left 1051156178 9:14148733-14148755 CCTGAGTACATTTGTAGATACTC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1051156179 9:14148785-14148807 AGTATTAACGATGTAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051156179 Original CRISPR AGTATTAACGATGTAGAAGA TGG Intronic
No off target data available for this crispr