ID: 1051161748

View in Genome Browser
Species Human (GRCh38)
Location 9:14216445-14216467
Sequence CTGTGGATACAGATGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051161748_1051161751 -10 Left 1051161748 9:14216445-14216467 CCAAGGTGCATCTGTATCCACAG 0: 1
1: 0
2: 3
3: 18
4: 207
Right 1051161751 9:14216458-14216480 GTATCCACAGGTAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051161748 Original CRISPR CTGTGGATACAGATGCACCT TGG (reversed) Intronic
902990106 1:20181481-20181503 CTATGGAGTCAGACGCACCTGGG - Intergenic
903753396 1:25644283-25644305 ATGTGGATATAGGTGCAGCTTGG + Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
906328112 1:44861288-44861310 CTTTAGATACAGAGGCTCCTGGG + Intronic
906810104 1:48817867-48817889 GTGTGCTTGCAGATGCACCTGGG + Intronic
906987626 1:50702246-50702268 CTGTGGTTACAAATGCACTTGGG - Intronic
907265803 1:53260107-53260129 CTGTGGAACCAGATAGACCTGGG + Intronic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
907947581 1:59149563-59149585 CTTTGAATTCAGATACACCTGGG + Intergenic
908965553 1:69757788-69757810 CTGTGGATACAGAAGCAAATGGG + Intronic
911585443 1:99684892-99684914 CTGTGGAATCAGGTGGACCTGGG - Intronic
912544827 1:110443130-110443152 CTGGGGATACAGAGGATCCTTGG + Intergenic
913287030 1:117235976-117235998 CTGTGGATAAGGTTGCACGTGGG + Intergenic
913485082 1:119326892-119326914 CTGTGGAATCCGATGGACCTTGG - Intergenic
915013024 1:152707789-152707811 CTGTGGAGAGAGATGCCCCTCGG - Intergenic
916015206 1:160743410-160743432 CTGTGGAAAGATATGCAGCTGGG - Intronic
917990327 1:180369326-180369348 CTGTTGATACATGTGCCCCTAGG - Intronic
919479002 1:198063367-198063389 CTGTGGGTACACTTGCATCTTGG + Intergenic
919921974 1:202171477-202171499 CTCTGGATGCAGATGCCCCTGGG - Intergenic
920077666 1:203348975-203348997 TTGTGGCTACACATGCAACTTGG + Intronic
920090239 1:203447617-203447639 CTCTGGAGTCAGATGCTCCTGGG + Intergenic
920379255 1:205526342-205526364 GTGAGGAGACAGATCCACCTGGG - Intronic
922007673 1:221548743-221548765 TTTTGGATTCAGATGGACCTGGG - Intergenic
922803956 1:228376281-228376303 CTGGGGAGACAGCTGCTCCTGGG + Intronic
924244155 1:242065417-242065439 CCGTGGATACAGTTTCACTTTGG - Intergenic
1062952679 10:1516368-1516390 CTCTGAATCCAGCTGCACCTCGG - Intronic
1065324856 10:24541670-24541692 CTGAGGCTACTGATACACCTTGG + Intronic
1067735113 10:48844649-48844671 TAGTGGATACACAAGCACCTGGG - Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1072791609 10:98322000-98322022 CTCAGGGTATAGATGCACCTGGG - Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075907360 10:126093287-126093309 AAGTGGAAACAGATGCACCTTGG - Intronic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078383707 11:10868399-10868421 CTGTGGATTCACATGCAGTTGGG + Intergenic
1078725636 11:13928335-13928357 TTGTGTATACATATGCACCTAGG + Intergenic
1083403785 11:62442913-62442935 ATGTGGATGAGGATGCACCTGGG + Intronic
1084358112 11:68652720-68652742 GTGTGGAAGCAGAGGCACCTTGG + Intergenic
1084431528 11:69114082-69114104 CGGTGGAGCCAGATGGACCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085065163 11:73488607-73488629 CTGTGGGTACAGGTGCAGTTTGG - Intronic
1086684058 11:89709996-89710018 CTGTGGCTACAGATGAGCCCAGG + Intergenic
1087183137 11:95158964-95158986 CTGTGGAGTCAGACACACCTAGG - Intergenic
1089508370 11:118979813-118979835 ATGTGGGCACAAATGCACCTGGG - Intronic
1089735621 11:120548518-120548540 ATGAGGCTACAGAGGCACCTCGG + Intronic
1089842430 11:121429914-121429936 CTGTGGATACAGTTCCAGTTAGG - Intergenic
1089927551 11:122274584-122274606 CTGTGCACACACATGCACGTGGG - Intergenic
1092004033 12:5054068-5054090 CAGTTGATACAGACGCTCCTTGG + Intergenic
1092026292 12:5243500-5243522 CTAGGGCTACAGATGAACCTGGG + Intergenic
1093515843 12:19986150-19986172 CTGTGGATTTAGGTGCATCTTGG + Intergenic
1093639341 12:21508088-21508110 CTGCAGACACAGATGCCCCTTGG + Intronic
1093676476 12:21946166-21946188 CTCTGCACACACATGCACCTCGG + Intergenic
1095188422 12:39228502-39228524 CTCTGTGTACAGATGTACCTGGG - Intergenic
1095197116 12:39332970-39332992 CTGTCGAAACAGATGCATCAAGG - Exonic
1095516101 12:43007204-43007226 CTGTGGATACAGTTGCTAGTGGG - Intergenic
1095844960 12:46734626-46734648 ATGTGGAGAAAGATGCAGCTTGG - Intergenic
1095881448 12:47141538-47141560 CTGTGGATCCTGAAGCAGCTTGG + Intronic
1096741820 12:53699067-53699089 CTGTGGATGCAGCTGCTCCAGGG - Intergenic
1098578779 12:72074321-72074343 TTCTGGAGACAGATGGACCTGGG + Intronic
1102227072 12:111236286-111236308 CTGTGGCTACTGATGTTCCTAGG - Intronic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1103044038 12:117720361-117720383 TTGTGCAGACAGGTGCACCTGGG - Intronic
1103720938 12:122975083-122975105 CTGCGGAGAAAGATGCTCCTGGG - Exonic
1106371766 13:29141479-29141501 TTGTGGTTACAGAAGCACATAGG + Intronic
1106442228 13:29786138-29786160 CTGTGGGCTCAGATGCACCTGGG - Intronic
1111301584 13:86357526-86357548 CTGTTCATAAAGATGCACTTTGG + Intergenic
1112669988 13:101624488-101624510 CTCAGGATACAGATTGACCTGGG + Intronic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114980541 14:28158294-28158316 CTGTGGATGCGGATGCCCCTTGG - Intergenic
1115101348 14:29704544-29704566 CTTTGGAGTCAGATGCACTTTGG - Intronic
1116015285 14:39399472-39399494 CTGTGGTTACATATGCAAGTAGG - Exonic
1117021497 14:51575441-51575463 CTGCAGATGCAGATGCTCCTTGG + Intronic
1119180873 14:72604629-72604651 CTGTGGACACAGATGACCCAGGG + Intergenic
1121258938 14:92552503-92552525 CTGTGGCTCCAGATGCTCATGGG + Intronic
1122078579 14:99251596-99251618 CTGTAAATTCAGGTGCACCTGGG - Intronic
1122196499 14:100091352-100091374 CTGTTGATTCAGATTCTCCTCGG - Intronic
1122247120 14:100411258-100411280 ATGGGGAAACAGAGGCACCTTGG - Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1124479051 15:30061700-30061722 CTGTTGATACAGGTGCCCATGGG - Intergenic
1124645583 15:31435713-31435735 CTGTGCATACACATGCATGTGGG - Intergenic
1125352436 15:38781932-38781954 CTGAGGATTCAAATCCACCTGGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127557307 15:60100015-60100037 CTCTGGAGTCAGAAGCACCTGGG + Intergenic
1128226138 15:66002521-66002543 CTGTGGACACCAATGGACCTGGG + Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1128799456 15:70488353-70488375 CTGTGGTTCCAGAGTCACCTGGG - Intergenic
1129928384 15:79385946-79385968 CTGTGGATTCTGGTGGACCTGGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1137973948 16:53014535-53014557 CTGTGAATCCAGATGCCTCTAGG - Intergenic
1138960497 16:62023325-62023347 TTCTGGAAACAGATACACCTGGG + Intronic
1139136497 16:64211142-64211164 CTTTGGAGACGGATACACCTAGG - Intergenic
1140923389 16:79560177-79560199 CTGGGACTACAGGTGCACCTGGG + Intergenic
1141213995 16:82007554-82007576 CTGTAGAGTCAGATGCACCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142778139 17:2157946-2157968 CTTTGGTTAGAAATGCACCTGGG - Intronic
1143880321 17:10024887-10024909 CGATGGGTACAGATGGACCTGGG - Intronic
1146795797 17:35779657-35779679 CTCTGGAGTCAGATCCACCTAGG + Intronic
1147555295 17:41475333-41475355 ATGTGGAGTCAGATGGACCTGGG - Intergenic
1147616675 17:41833035-41833057 CTGTGGATCCAGGTGCTCCCTGG - Intronic
1149546316 17:57506389-57506411 CTGTGCATACAAATACACCACGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151426524 17:74034377-74034399 CTGTGGATACAAATCCCCCCAGG - Intergenic
1151537227 17:74745773-74745795 CAGGGGACACAGATGCACTTTGG + Exonic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155673986 18:28407520-28407542 CTGTAGAAAAAGATACACCTTGG + Intergenic
1158778731 18:60619926-60619948 CTGTGGATATATATGCACACAGG - Intergenic
1160064132 18:75559286-75559308 CTGTGGAGTCAGTTGCACATTGG + Intergenic
1162212356 19:9102437-9102459 CTGTGGTTACTGACTCACCTAGG - Exonic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1165103009 19:33450043-33450065 CTGCGGAGACAGAGGCAGCTTGG - Intronic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166711570 19:44941025-44941047 CTCTGGCTTCAGATGGACCTGGG - Intergenic
926270727 2:11364166-11364188 CTGGGGATACAGAAGCAAGTAGG + Intergenic
926838922 2:17056822-17056844 ATTTGGATACAGATGCACAGAGG + Intergenic
927679376 2:25129952-25129974 CTGGGGAGACAGAGGCACATGGG - Intronic
928219709 2:29393490-29393512 CTGTGGGTTCAGATTCTCCTTGG - Intronic
928687609 2:33765006-33765028 CACTGGAGACAGATTCACCTTGG + Intergenic
929953715 2:46438491-46438513 ATGTGGATGCTGAGGCACCTGGG + Intronic
930026648 2:47033288-47033310 CTGTGGATACAGATCTTACTGGG - Intronic
931196406 2:60056012-60056034 CTGTGGGTTCAGATGCAGGTAGG + Intergenic
937643685 2:124242238-124242260 CAGTGGCTCCAGATGGACCTGGG + Exonic
937875721 2:126823960-126823982 CTGTGGCTACAGATGAGCCTTGG + Intergenic
938392002 2:130914233-130914255 CCGTAGATATAGAAGCACCTTGG + Intronic
939015818 2:136902796-136902818 CATTGGATACAAAAGCACCTGGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
941428918 2:165388149-165388171 CTTTGGAGACAGATGTACTTGGG - Intronic
944209336 2:197190158-197190180 ATATGCATACATATGCACCTAGG + Intronic
948616628 2:239203259-239203281 AGGTGGACACAGGTGCACCTGGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170037972 20:12010155-12010177 ATTTTTATACAGATGCACCTTGG - Intergenic
1170982317 20:21226313-21226335 TTGTGGATCCAGATGCCTCTAGG - Intronic
1171201528 20:23245952-23245974 CTGGGAGTACACATGCACCTTGG + Intergenic
1171318159 20:24214158-24214180 CTGTGTACTCAGATGCACCTTGG - Intergenic
1171979671 20:31618725-31618747 CTGGGACTACAGATGCACCCTGG - Intergenic
1174446959 20:50596919-50596941 CACTGGATACTGCTGCACCTTGG + Intronic
1174635118 20:51992778-51992800 CTCTGGATTCAGATGAGCCTGGG + Intergenic
1175458135 20:59130561-59130583 CTGTGGATGTGGGTGCACCTTGG + Intergenic
1177717105 21:24853094-24853116 CTTTGGAGACAGAGGCATCTTGG - Intergenic
1177990751 21:28033156-28033178 TTCTGTATACAGATGCTCCTAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
955083295 3:55677654-55677676 CTCTGGATTCAGATAGACCTAGG - Intronic
955160258 3:56458585-56458607 GGGTGGATACAAAAGCACCTGGG - Intronic
955303707 3:57809177-57809199 GTGTGGCTGCAGCTGCACCTGGG - Intronic
955584367 3:60460567-60460589 CTGTTTATTCAGATCCACCTTGG + Intronic
956272445 3:67462353-67462375 CTGTCTATACAGATGCTTCTTGG - Intronic
957742104 3:84283426-84283448 ATGTTGATACTGATGCTCCTGGG + Intergenic
961542990 3:127612815-127612837 CTTTGGATTCAGATGCATCTGGG + Intronic
963767117 3:149348933-149348955 CTGTTTATACTGATGCATCTTGG + Intergenic
967082313 3:186061514-186061536 CTGTGGCAACAGCTTCACCTGGG - Intronic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972494191 4:39617966-39617988 CTTTGATTGCAGATGCACCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974737084 4:65950099-65950121 TTGTGCATACACATTCACCTAGG - Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
976390584 4:84500329-84500351 CTTTAGATACAGAAGCATCTAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
983634286 4:169882072-169882094 CTGTGGATCAAGATGCACCTGGG - Intergenic
983696264 4:170535741-170535763 CTTCGGTTACAGATGTACCTGGG - Intergenic
983954227 4:173677998-173678020 TTGGGGTTACAGATGCTCCTAGG + Intergenic
984267022 4:177507586-177507608 CTGTGAATATAAATGCACTTAGG + Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984326402 4:178258412-178258434 TTGTGGATACAGAATGACCTTGG - Intergenic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
987905437 5:24069908-24069930 CTTTGGCAACAGACGCACCTAGG + Intronic
990973502 5:61536071-61536093 CAGTGAATACAGATGTGCCTTGG - Intronic
992839026 5:80668748-80668770 CTGTGGCTGCAGCTGCACCCAGG + Intronic
994245513 5:97471623-97471645 AGGTGGCTACAGCTGCACCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995382048 5:111546373-111546395 TTGTCTTTACAGATGCACCTTGG + Intergenic
997472855 5:134126316-134126338 GTGTGGGGACAGATGAACCTGGG + Intronic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1005997013 6:30937580-30937602 CTGTGGAGCCACATTCACCTGGG + Intergenic
1006185639 6:32180188-32180210 CTGTGGAAGCATATGCTCCTAGG - Intronic
1006828731 6:36955983-36956005 CTGAGAGAACAGATGCACCTTGG + Intronic
1011083486 6:83513492-83513514 CTGTGGAGACAAATGTACTTCGG - Intronic
1011141427 6:84161788-84161810 TTCTGGATAAAGATGCACTTCGG - Exonic
1012270378 6:97202675-97202697 CTTTGGAGTCAGATACACCTGGG - Intronic
1013627939 6:111956204-111956226 GTATAGATACAGATGCACGTAGG + Intergenic
1015370356 6:132443998-132444020 CTTTGGAGAAAGATGCTCCTGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1020041789 7:5009141-5009163 CTGGGGAGACAGATGCATTTAGG + Intronic
1021384305 7:20009116-20009138 CTATGGATGTGGATGCACCTTGG + Intergenic
1021658152 7:22892306-22892328 CTATGGATTCAAATGCCCCTGGG - Intergenic
1023340389 7:39213313-39213335 CTGTGGATGCTGAAGTACCTGGG + Intronic
1023480353 7:40627297-40627319 CTGTGGATACAGAATCTTCTTGG + Intronic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1026231920 7:68491255-68491277 CTGTGGAAACAGATGCCCCCTGG - Intergenic
1027144316 7:75683498-75683520 CTGTGTGTGCAGATGCACCCTGG + Intronic
1027876387 7:83774879-83774901 TTTTGTATACAGATGCTCCTAGG + Intergenic
1029926424 7:104323983-104324005 GTGTGGATACAGATGCCTTTAGG + Intergenic
1034108043 7:148508051-148508073 CTATGGCTACAAAAGCACCTGGG - Intergenic
1034253186 7:149708676-149708698 CTGTGAAAACTGAAGCACCTTGG - Intergenic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1035816473 8:2546725-2546747 CCGTGAATACAGAGGCATCTCGG - Intergenic
1038745327 8:30249700-30249722 CAGTGGATCCTGATGAACCTGGG - Intergenic
1039310775 8:36315967-36315989 CTGTGCATATAGATGCACCAAGG + Intergenic
1039617583 8:38968767-38968789 CTGGGGCTTCAGCTGCACCTCGG - Intronic
1043523936 8:81075705-81075727 CTGTGGAATCAGGTGCACTTGGG - Intronic
1045586904 8:103548041-103548063 CTGTGGATTCATCTGCTCCTGGG - Intronic
1045940410 8:107732095-107732117 CTGTGGTTACAGCTCAACCTGGG - Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1055658447 9:78475741-78475763 CTTTGGAGTCAGATGCACCTGGG - Intergenic
1055884461 9:81044177-81044199 CTGTGGATCCAGCTGCACTGTGG - Intergenic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1059161768 9:112041547-112041569 CTGTGCATAGAGATGCACAGTGG - Intronic
1059987666 9:119835887-119835909 CTGGGGATACTGAGGCACCCAGG - Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061414327 9:130438224-130438246 CTCTGGAGTCAGATGGACCTGGG - Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1062331229 9:136045826-136045848 CTGTGGATCCAGATGTGCCAAGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186393455 X:9183823-9183845 CAATGTATACAGAAGCACCTTGG - Intergenic
1187263135 X:17705652-17705674 CTGTGGATTCATAAGAACCTTGG - Intronic
1190879297 X:54481572-54481594 CTCTGGACACAGACACACCTGGG - Intronic
1190998689 X:55637116-55637138 CAGTGGCTACAGCTGCACCCAGG - Intergenic
1192233274 X:69280225-69280247 CTTTGGAGTCAGAGGCACCTAGG + Intergenic
1195587646 X:106584090-106584112 TTGTTGATACAGTTGGACCTTGG - Intergenic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1199540658 X:148954686-148954708 CTCTGGATACACATGGACCAGGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic