ID: 1051161928

View in Genome Browser
Species Human (GRCh38)
Location 9:14218476-14218498
Sequence TGTGAGACGCTGAAGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051161926_1051161928 25 Left 1051161926 9:14218428-14218450 CCAACACAGCTTTTATCAGGTGC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1051161928 9:14218476-14218498 TGTGAGACGCTGAAGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051161928 Original CRISPR TGTGAGACGCTGAAGGTGCA TGG Intronic
No off target data available for this crispr