ID: 1051162016

View in Genome Browser
Species Human (GRCh38)
Location 9:14219589-14219611
Sequence CCATAAAATACGTGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051162016_1051162020 29 Left 1051162016 9:14219589-14219611 CCTGCTTTACACGTATTTTATGG 0: 1
1: 0
2: 0
3: 10
4: 68
Right 1051162020 9:14219641-14219663 GTTTTGTTTCTTTTACTAAATGG No data
1051162016_1051162019 -5 Left 1051162016 9:14219589-14219611 CCTGCTTTACACGTATTTTATGG 0: 1
1: 0
2: 0
3: 10
4: 68
Right 1051162019 9:14219607-14219629 TATGGAGGAGTTACTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051162016 Original CRISPR CCATAAAATACGTGTAAAGC AGG (reversed) Intronic
902781945 1:18710732-18710754 CAATAAAATATGTGTGAAGGAGG - Intronic
913510849 1:119560453-119560475 CAATAAAATACATGAAAAGATGG + Intergenic
913515072 1:119597858-119597880 CAATAAAATACATGAAAAGATGG + Intergenic
914323308 1:146586350-146586372 CCATAAAATACTTGATATGCAGG - Intergenic
914427404 1:147590252-147590274 CCATAAAATTGGTGGAAAGCAGG - Intronic
923230971 1:231985927-231985949 TCATAAAATGCGTGAAAATCTGG + Intronic
923438688 1:233994675-233994697 CCATAAAATACTTTTATACCAGG - Intronic
1064138355 10:12769625-12769647 TTACAAACTACGTGTAAAGCTGG - Intronic
1068266391 10:54655690-54655712 CCAGAAAATTCTTCTAAAGCAGG + Intronic
1073876963 10:107935997-107936019 CAAGAAAATTTGTGTAAAGCAGG + Intergenic
1074673292 10:115820351-115820373 CCATAAACACTGTGTAAAGCTGG - Intronic
1079844505 11:25448187-25448209 CCATTAAATATGTGCAAAACAGG + Intergenic
1081016036 11:37882126-37882148 CCCAAAAATAAGTGTAAAACAGG - Intergenic
1082769441 11:57195436-57195458 CCATGAGATAGGTGTAAAGCTGG - Intergenic
1086744409 11:90406954-90406976 ATAAAAGATACGTGTAAAGCAGG + Intergenic
1104895957 12:132163699-132163721 CTTTAAAATATGTGTAGAGCAGG - Intergenic
1110284828 13:73737578-73737600 TCATAAAATACCTGTGAATCAGG + Intronic
1116374151 14:44176144-44176166 CTATAAAATATGTGTTAAGAGGG - Intergenic
1117081048 14:52152052-52152074 CCATAAAATAAATGTACAGGAGG - Intergenic
1122737645 14:103852611-103852633 CCATAAAAAACAAGGAAAGCTGG - Intergenic
1123138518 14:106052958-106052980 CCATCAAATACCTGTAAGTCTGG + Intergenic
1125113178 15:36057759-36057781 CCTTAAAATACTTGTAGAGCAGG + Intergenic
1129421833 15:75434347-75434369 TAATAAAAAACGTGTAAAGTAGG + Intronic
1130681156 15:85997951-85997973 GCATAAAATACGTTTGAAGCAGG + Intergenic
1138050687 16:53774131-53774153 GGATAAAATAGGTTTAAAGCAGG + Intronic
1138174907 16:54888339-54888361 TAATAAAATAAGTGAAAAGCTGG + Intergenic
1138525406 16:57603076-57603098 CAATTAAAAATGTGTAAAGCAGG + Intergenic
1140010255 16:71124500-71124522 CCATAAAATACTTGATATGCAGG + Intronic
1150586742 17:66525495-66525517 CCACAAAACACGTGTACAGCTGG - Intronic
1153631111 18:7070842-7070864 CCTTAAAAAACTTTTAAAGCCGG - Intronic
1156087477 18:33424326-33424348 CTATATTATAGGTGTAAAGCTGG - Intronic
930132452 2:47866299-47866321 CCAAAAATAACGTGGAAAGCAGG + Intronic
940722801 2:157300053-157300075 CATTAAAATACCTCTAAAGCAGG + Intronic
944339276 2:198576965-198576987 CCATAGAATACATGGAAATCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1175415345 20:58797202-58797224 CCAGAAAACACTTGTAAGGCCGG - Intergenic
1178486402 21:33022485-33022507 CCGTAAAATACATGTAAATGTGG - Intergenic
1181781809 22:25199268-25199290 CCATACAATGCTTGTGAAGCTGG + Intergenic
951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG + Intergenic
953594192 3:44292640-44292662 CAATAAAAAAAGTGAAAAGCTGG - Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
956559616 3:70560224-70560246 CCTGAAAAGACGTGTAAAGGTGG - Intergenic
956684461 3:71811786-71811808 ACATAAAAAACCTGTAAAGAAGG - Intergenic
959670787 3:108974515-108974537 CCATAAAGTACATTTAAAGGTGG + Intronic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
979992681 4:127393593-127393615 GAATCAGATACGTGTAAAGCAGG + Intergenic
981736141 4:147952672-147952694 GAAGAAAATACTTGTAAAGCAGG - Intronic
982525516 4:156472974-156472996 TCATAAAATAAGTGTAAATGTGG + Intergenic
986716985 5:10532002-10532024 ACTTAAAATACGTGTATGGCTGG + Intergenic
986854697 5:11855105-11855127 GCATAAAAAACCTGTAATGCCGG + Intronic
993393467 5:87352676-87352698 TCATAAAACACATGAAAAGCAGG - Intronic
993921591 5:93811510-93811532 CCCTGAAATACGTGAAAAACCGG + Intronic
994030934 5:95141783-95141805 ACATAAAATATGTTTAGAGCAGG + Intronic
994969854 5:106721729-106721751 CCACAGTATACGTGTAAAACAGG - Intergenic
1002410159 5:179068205-179068227 CCATGAAATGCTAGTAAAGCAGG + Intronic
1006976848 6:38110426-38110448 ACAGAAAGTACCTGTAAAGCAGG + Intronic
1020957915 7:14765689-14765711 CAATAAAATACGTATAAAGGTGG - Intronic
1023583220 7:41703909-41703931 CCTTGAAATAGGGGTAAAGCTGG + Intergenic
1023929523 7:44696803-44696825 CCAGAAACTACGAGTAAAGAAGG + Intronic
1029803461 7:102974088-102974110 TCATAAAAAACCTGTAAACCTGG + Intronic
1033993336 7:147314781-147314803 GCAGAAAATACATGTAAAGGGGG + Intronic
1034085261 7:148316562-148316584 GCATAAAATAGGTGTAAATAAGG - Intronic
1034992725 7:155558384-155558406 CGAAAAAATACTTGAAAAGCAGG + Intergenic
1037110824 8:15162566-15162588 CCATAAGATAAGTGAAAAGCTGG - Intronic
1039549757 8:38434705-38434727 CCAGAAAACACCTGTGAAGCTGG - Intronic
1041137048 8:54770233-54770255 CTATAAAAAATGTGTAAGGCTGG - Intergenic
1043667718 8:82838426-82838448 GCATAAAATAGATGTAAAGTTGG - Intergenic
1045255280 8:100514948-100514970 CAATGAAATATGTGTAAAGATGG - Intronic
1045812716 8:106242344-106242366 CCATAAATTATGTGAATAGCAGG + Intergenic
1048014897 8:130488580-130488602 CCATAAAATGAGGGTAATGCTGG + Intergenic
1048709090 8:137187907-137187929 CCATAAAATAGCTGGAAAGGAGG + Intergenic
1051162016 9:14219589-14219611 CCATAAAATACGTGTAAAGCAGG - Intronic
1052634100 9:31078577-31078599 AGATAAAATACTTATAAAGCAGG + Intergenic
1052761207 9:32593570-32593592 CCATTAAATACGTTAATAGCTGG - Intergenic
1054876588 9:70103679-70103701 CCATAAAAAAGGTGAAAAGACGG + Intronic
1058393943 9:104527870-104527892 CCATCATATACTTGTAGAGCTGG - Intergenic
1059372390 9:113852972-113852994 CCAAAAAATACCCATAAAGCTGG - Intergenic
1193505793 X:82342143-82342165 CCATAGAATAAGTTCAAAGCAGG + Intergenic