ID: 1051164529

View in Genome Browser
Species Human (GRCh38)
Location 9:14247820-14247842
Sequence CCTGTTCCTGCTTTTAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051164529 Original CRISPR CCTGTTCCTGCTTTTAGTTT AGG (reversed) Intronic
905519990 1:38590162-38590184 TCTGTTTCTGCTTATAGCTTTGG - Intergenic
905989302 1:42319782-42319804 CCTGTTCCAGCTTTGGGGTTTGG - Intronic
906858573 1:49333939-49333961 CCTGCATCTGCTCTTAGTTTGGG - Intronic
907841168 1:58158815-58158837 CCTGTGCCTGCATTTGCTTTGGG - Intronic
909383360 1:75027678-75027700 CCTGTTTCTGCCTTTTGATTAGG - Intergenic
910741263 1:90520291-90520313 CATGTTCCTGATCTTAGTTAGGG - Intergenic
912725236 1:112053396-112053418 AGAGTTCCTGGTTTTAGTTTGGG + Intergenic
912774899 1:112500333-112500355 TCTTTTCATGCTTTTTGTTTTGG + Intronic
913096517 1:115522389-115522411 CCTTCTCCTGCTTATGGTTTAGG - Intergenic
913546467 1:119873656-119873678 TCTGTGGCTGCTTTTGGTTTTGG + Intergenic
913567316 1:120085460-120085482 TCTGCTCCTGTTTTTAGGTTAGG - Intergenic
913630818 1:120708086-120708108 TCTGCTCCTGTTTTTAGGTTAGG + Intergenic
914244959 1:145878580-145878602 TCTTTTCCTGCTTTTAGGATTGG - Intronic
914288064 1:146246166-146246188 TCTGCTCCTGTTTTTAGGTTAGG - Intergenic
914549100 1:148696912-148696934 TCTGCTCCTGTTTTTAGGTTAGG - Intergenic
914617582 1:149374807-149374829 TCTGCTCCTGTTTTTAGGTTAGG + Intergenic
915358166 1:155268998-155269020 CCTGTTCCTGTTTTGGGTTTGGG - Intronic
916544059 1:165785485-165785507 CCTCTTTTTGGTTTTAGTTTCGG - Intronic
917452800 1:175161107-175161129 CCTCTTCCAGCTTTGGGTTTGGG + Exonic
917635034 1:176927332-176927354 CCTTTTCTTGCTATTACTTTTGG - Intronic
917705637 1:177631468-177631490 CCTCTTCCTTCTTTTACTTCAGG - Intergenic
918181228 1:182087227-182087249 GCTGTTCCCGCTTTGATTTTAGG - Intergenic
920629556 1:207638422-207638444 CCTGTAACAGCCTTTAGTTTAGG + Intronic
921143428 1:212328116-212328138 TTGGTTCCTGCTTTTAGTTGAGG + Intronic
921439367 1:215166378-215166400 CCCATTTCTGCTTTTAATTTTGG - Intronic
921808773 1:219487623-219487645 CATTTTCCTGCTTTTCGTGTAGG + Intergenic
921814545 1:219548886-219548908 CCTGATCTTACTTTCAGTTTGGG + Intergenic
923503781 1:234588268-234588290 CCTCTTCCTGATTTTTATTTAGG - Intergenic
924224402 1:241908851-241908873 CCTGTTGTTGCATTTATTTTAGG + Intergenic
924760950 1:246985213-246985235 CATATACATGCTTTTAGTTTTGG - Intronic
924906627 1:248460535-248460557 CCTATTTCTCATTTTAGTTTAGG + Intergenic
1064379125 10:14824640-14824662 CCTTTTCTTGCTGTTTGTTTTGG + Intronic
1064478223 10:15714745-15714767 CCTGTTCCTCCATTTATTTAAGG - Intronic
1065075688 10:22076945-22076967 CCTGTTCCTGGATTTTTTTTTGG + Intergenic
1065486314 10:26239388-26239410 CCTGGTCTTGCTTTTAGAATAGG + Intronic
1067908616 10:50320788-50320810 CCTATTCCTCCTTTGAGATTGGG + Intronic
1071508075 10:86244965-86244987 CCTGGTGCTCCTTTTAATTTGGG - Intronic
1071836708 10:89425351-89425373 CCTGTAAGTGATTTTAGTTTTGG - Intergenic
1071862685 10:89690464-89690486 CCGGTTCTTCATTTTAGTTTAGG + Intergenic
1074194829 10:111174447-111174469 TCTCTTAGTGCTTTTAGTTTTGG + Intergenic
1078019863 11:7647922-7647944 CAAGTTTTTGCTTTTAGTTTTGG + Intronic
1078022562 11:7667932-7667954 CTGTTTCCTGCTTTGAGTTTTGG - Intronic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1078742639 11:14081541-14081563 CCTATGCCTGCCTTTTGTTTGGG + Intronic
1078908326 11:15708059-15708081 GCTGTTCCTGATTTTAGTTGAGG + Intergenic
1079110993 11:17605140-17605162 CCTGTGCCTGCTTGTGGATTTGG + Intronic
1079614450 11:22473705-22473727 CCTGTTCCTGGTTCCAGTTGAGG - Intergenic
1081343452 11:41955552-41955574 CCTCTTCCTCTTTTTAGTTAAGG - Intergenic
1082098120 11:48147824-48147846 CATGCTCCAGCTTTTAGGTTAGG + Intronic
1083127143 11:60581509-60581531 CCTTTTCCTGGTTTTGGTATTGG - Intergenic
1085667275 11:78425768-78425790 TCTCTTCCAGTTTTTAGTTTTGG + Intergenic
1085786607 11:79457130-79457152 CCTCTTTCTCCTTATAGTTTTGG - Intergenic
1086322512 11:85664975-85664997 CCTTTCCCTGCATTTCGTTTCGG - Exonic
1086934092 11:92725126-92725148 CCTGCTCCTGATTTTCCTTTTGG - Intronic
1086977111 11:93145793-93145815 CCAGCTCTTGCTTTTATTTTGGG - Exonic
1087079835 11:94159459-94159481 CTTCTTCCTGGTTTTAGTCTTGG + Intronic
1087931004 11:103977501-103977523 ACTGTTCATGCATTTAGTATTGG + Intronic
1088967907 11:114742973-114742995 CCTTTTGCTGCTTTTATTTGGGG + Intergenic
1089026159 11:115271936-115271958 CATTTTCATGCTTTTAGTCTGGG - Intronic
1091533022 12:1377934-1377956 TCTGTTTCAGCTTTCAGTTTTGG + Intronic
1091948701 12:4572950-4572972 TTTGTTCCTGCTTTTCGTATAGG - Intronic
1092083175 12:5735004-5735026 CCTGTCTCTTCTTTGAGTTTCGG - Intronic
1092451569 12:8607195-8607217 CCTTTTCCTGCTTATATTTAAGG + Intronic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1096189551 12:49606646-49606668 CCTATTCCTCCTTTCAGTTCTGG - Intronic
1097553412 12:61105009-61105031 CCTTTTGATGCTGTTAGTTTGGG + Intergenic
1098632823 12:72745228-72745250 CTTCTTCCTTCTTTTTGTTTAGG - Intergenic
1098904927 12:76152281-76152303 CATGTTCCTATTTTTAGTGTTGG - Intergenic
1101411308 12:104470772-104470794 CCTGTTCCAGCTTTCCGATTAGG - Intronic
1101438072 12:104680831-104680853 CCTGTTCCTGCTGTGAGTGAAGG + Intronic
1103349496 12:120273865-120273887 ACTGGTCATTCTTTTAGTTTTGG - Intergenic
1103736599 12:123064679-123064701 CCTGTTCCTGCTGTTGTATTTGG - Intronic
1104073201 12:125365123-125365145 TCTTTTCCTGCTTTTTTTTTGGG + Intronic
1104485658 12:129149436-129149458 CATGTTCCTGCTTTTGTTTCAGG - Intronic
1106162776 13:27215614-27215636 CCTGATCTTGCTTTTCCTTTTGG - Intergenic
1107213734 13:37890514-37890536 TCTGTTTCTGCTCTTAATTTAGG - Intergenic
1107887962 13:44890318-44890340 CCAGTTCCTGCTGTTAGCTCTGG - Intergenic
1108233882 13:48380976-48380998 CCTGTTCCTGATATAAGTTTAGG + Intronic
1108529339 13:51314442-51314464 CCTCTTCCAACTTTTATTTTAGG - Intergenic
1109122703 13:58478122-58478144 CCCTTTCTTGCTTTTAGTATAGG - Intergenic
1112083781 13:96005970-96005992 CTTGACCCTGCCTTTAGTTTAGG - Intronic
1112148472 13:96729375-96729397 CATCATCCTGCTTTTAGTTCAGG - Intronic
1117595151 14:57319807-57319829 CCTGTTCGTGCTTTAAGGTCAGG - Intergenic
1119650228 14:76377837-76377859 ACTGTTCCTGCTTCTAGTTTGGG + Intronic
1119691892 14:76679641-76679663 CGTGTTCCTCCTCTTACTTTCGG + Intergenic
1120718980 14:87869997-87870019 TCTTTGCCTGGTTTTAGTTTTGG - Intronic
1121152624 14:91650590-91650612 AGTGTTTCTGCTTTTAGTGTTGG + Intronic
1121476949 14:94217525-94217547 CCTGTTGTTGCTTTATGTTTTGG - Intronic
1121754677 14:96392491-96392513 CCTGTTCCTCCTTTTAATGAGGG + Intronic
1122358077 14:101136240-101136262 CATGTTCCTGATTTCAGATTTGG + Intergenic
1122677612 14:103429520-103429542 CCTGTCCCTGTTTTGTGTTTGGG + Intronic
1123826849 15:24091278-24091300 TTTGTTTCTGTTTTTAGTTTTGG + Intergenic
1124604180 15:31158704-31158726 CGTGTTCCTCCTTTTACTTTTGG - Intronic
1125908330 15:43414116-43414138 CTTGCTCCTGGTTTTATTTTAGG - Intronic
1127198068 15:56612021-56612043 CGTGTTCCTCCTCTTACTTTCGG + Intergenic
1127352364 15:58166084-58166106 CCTGGTCCTGCTTTTATACTGGG + Intronic
1127438253 15:58979645-58979667 CCTGCTCCTGTTTTTAGCCTAGG + Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1128474038 15:67981902-67981924 CCAGTTCCTGCTTTCATTTTGGG - Intergenic
1128873340 15:71181445-71181467 CATCTTCAGGCTTTTAGTTTGGG + Intronic
1128983715 15:72204164-72204186 CCTGGTACTGCTCTTAGTTATGG + Intronic
1128990182 15:72253351-72253373 CCTGTACCTTCTTTTAGTGGTGG - Intronic
1131068154 15:89447615-89447637 CCTGTTCCTGCTTGTGGCTGAGG - Intergenic
1132187418 15:99813683-99813705 CATTTTTATGCTTTTAGTTTTGG - Intergenic
1133080775 16:3318136-3318158 CATGTTACTGCTTTTTGTTTTGG - Exonic
1136869992 16:33798195-33798217 CCTTTTCTTCCTTTTTGTTTCGG + Intergenic
1138164262 16:54785595-54785617 CCTGCTCCTGCTTGTATTTTGGG - Intergenic
1139225980 16:65233775-65233797 CCTGGTCCGGCTTACAGTTTCGG - Intergenic
1140471872 16:75219977-75219999 CCTGTTTTTGGTTTTGGTTTTGG + Intronic
1141086618 16:81100271-81100293 CCTCTTCCAGCTTTTGGTGTTGG - Intergenic
1203102179 16_KI270728v1_random:1317859-1317881 CCTTTTCTTCCTTTTTGTTTCGG - Intergenic
1143920893 17:10330308-10330330 TCACTTCCTGCTTTTAGTCTTGG - Intronic
1143938778 17:10516089-10516111 TCTGTTCCTCCCTTTTGTTTTGG - Intronic
1148254845 17:46121227-46121249 CCAGTTCCTGCTTTGAGTAGAGG - Intronic
1149818820 17:59754088-59754110 CCTGTTTCTGCTTTAAAGTTTGG + Intronic
1150632820 17:66892099-66892121 CCTTTTCTTGCATTTTGTTTGGG - Intergenic
1152968849 18:142134-142156 CCTCTGCCTGCTTCTATTTTTGG - Intergenic
1153379768 18:4425325-4425347 CATGTTCATGCTTTTATTTGAGG + Intronic
1153786338 18:8538359-8538381 CCTGTTCATTGTTTTATTTTTGG - Intergenic
1155222750 18:23700142-23700164 CATGTTCCTCCTCTTACTTTCGG + Intronic
1155335103 18:24755601-24755623 CATGCTTCTTCTTTTAGTTTTGG + Intergenic
1155391663 18:25344485-25344507 AATGTTCCTGTTTTTTGTTTGGG - Intronic
1156499391 18:37547529-37547551 CCAGGTCCTGCCTTTAGTCTTGG + Intronic
1157034809 18:43958649-43958671 CCTGTCCCTGCTTTCAGGTAGGG - Intergenic
1157630223 18:49087941-49087963 CCTGTGCCTGCTTTTTGATGGGG + Intronic
1158008605 18:52702378-52702400 CCTGGTCATGATTCTAGTTTTGG - Intronic
1158107338 18:53900617-53900639 CATGTTCCACCTTCTAGTTTTGG - Intergenic
1158495558 18:57952187-57952209 CCTGTTCCAGGTTTAAGTTCTGG + Intergenic
1158896024 18:61913951-61913973 ACTGTTTCTGGTTTCAGTTTTGG - Intergenic
1159979786 18:74764192-74764214 CCTGTTCCACCTTGTATTTTTGG + Intronic
1160098021 18:75893440-75893462 CTTGTTCCTGCTTTCAGTTAAGG + Intergenic
1161802163 19:6422310-6422332 CCTGCTGCTGCCTTTAGCTTAGG - Intronic
1162592698 19:11603149-11603171 CTGGTTTCTGCATTTAGTTTGGG + Intronic
1162917172 19:13880824-13880846 CCTTCTCCTTCTTTGAGTTTCGG + Intergenic
1165215106 19:34265469-34265491 TCTGTTCCTGCCTTTGGCTTGGG + Intronic
1166029413 19:40115633-40115655 CCATTTCCTTCTTTTTGTTTTGG + Intergenic
1166605695 19:44141083-44141105 ACTCTTCCAACTTTTAGTTTTGG + Intergenic
925155191 2:1643585-1643607 TCTGATCCTGCTTTCATTTTGGG - Intronic
926261767 2:11270551-11270573 CCTCTACATGCTTTCAGTTTTGG + Intronic
927516662 2:23675496-23675518 TCTGTTCTTGGTTTTTGTTTGGG + Intronic
927628060 2:24745008-24745030 CATGTTCCTTCATTTACTTTGGG - Intronic
928778050 2:34790427-34790449 CCTCTTTCTTCTTTCAGTTTTGG + Intergenic
928827183 2:35437184-35437206 CCTGTTCCTGCTTTAACTGATGG - Intergenic
929491659 2:42402382-42402404 CCTTTTAATGGTTTTAGTTTTGG + Intronic
929675109 2:43918711-43918733 CCTGTTTCTGATTTTGATTTCGG - Intronic
935648922 2:105365574-105365596 CTCATTCCTGCTTTTATTTTAGG - Intronic
937141423 2:119605164-119605186 TCTGCTCCTGCCTTCAGTTTTGG + Exonic
938148279 2:128857361-128857383 ACAGTTTCTGCTTTTAATTTGGG + Intergenic
939533363 2:143393097-143393119 TCTGTCCCTGTTTTCAGTTTTGG + Intronic
939640133 2:144630606-144630628 CATCTACCTGCTTTCAGTTTTGG - Intergenic
940827114 2:158424998-158425020 CCTGTTCTTCCTTTTTGTTTTGG - Intronic
942973035 2:181980264-181980286 CCTCTCCCTGCTTTTTGTTTTGG - Intronic
944371744 2:198992142-198992164 CATGTGCCTTCTTTTATTTTTGG - Intergenic
944812646 2:203343099-203343121 CAGGTGCTTGCTTTTAGTTTTGG - Intronic
945637121 2:212369156-212369178 ACTTTTCCTCCTTTTAATTTTGG - Intronic
946540465 2:220678858-220678880 CCTGTTGCTGTTGTTTGTTTTGG + Intergenic
946822385 2:223643599-223643621 CCTGTTCCCATTTTTATTTTAGG - Intergenic
948228108 2:236328655-236328677 CCTCTTCCTTCTTTTAGCCTTGG + Intronic
1168827134 20:821605-821627 CCTGTCCCTGCTCTGATTTTGGG + Intergenic
1169872399 20:10262023-10262045 CATGTGCCTGCTTTTAATTCAGG + Intronic
1171145653 20:22779773-22779795 CCTGTACTTCCTTCTAGTTTTGG + Intergenic
1171269580 20:23803365-23803387 CCTTTACCTTGTTTTAGTTTTGG - Intergenic
1174144369 20:48440806-48440828 CCCGGTCCTGATTTTATTTTTGG - Intergenic
1175762175 20:61568696-61568718 CCTGTGCCTCCTTTGGGTTTTGG + Intronic
1176004879 20:62855867-62855889 CCAGTTTCTGCTTTAAGTTCAGG - Intronic
1178938293 21:36883125-36883147 GTTGTTTCTGCTTTTTGTTTTGG - Intronic
1179992586 21:44956101-44956123 CCTTTTCCTGTTTTTCTTTTCGG + Intronic
1180231424 21:46429024-46429046 CCATTCCCTGCTCTTAGTTTTGG + Intronic
949788355 3:7766149-7766171 CCTCCTCCTCCTTTTAGGTTAGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950620840 3:14203962-14203984 CCTTTTCCTGCTCTTAGCCTTGG + Intergenic
951715383 3:25638215-25638237 TATGTTCCTGCTTTAATTTTTGG - Exonic
951847302 3:27098067-27098089 CCTCTTTCTGCTTTCATTTTTGG - Intergenic
954732760 3:52678543-52678565 CCTGTTCATCCTTATAGTCTCGG + Exonic
957012474 3:75023812-75023834 CTTGTTCCTGCTTTTAATTTTGG + Intergenic
957496257 3:80994871-80994893 CTTGTTCCTTCTTTTCTTTTAGG - Intergenic
959993126 3:112650915-112650937 TCTATTGCTGCTTTAAGTTTGGG + Intergenic
960854459 3:122088336-122088358 CTTTTGCCCGCTTTTAGTTTGGG + Intronic
962476714 3:135761345-135761367 CCCTTTCCTGCTCATAGTTTAGG - Intergenic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
962991576 3:140582248-140582270 CCTGTTCCTTCTTTCAGTGAAGG - Intergenic
962997805 3:140649006-140649028 GTTGTTGCTGCTTATAGTTTTGG - Intergenic
963470215 3:145731051-145731073 ACTGTTCTTTCTTTTAGATTTGG + Intergenic
964465520 3:156987415-156987437 TCTGTTCCTGCTTCTAGATTTGG + Intronic
965751857 3:171983640-171983662 CCTGTTCCTGCTAATTTTTTTGG - Intergenic
965967847 3:174517462-174517484 AGTGTTTCTGCTTTTACTTTTGG + Intronic
966059767 3:175740741-175740763 CATGTTCCTCCTCTTACTTTAGG + Intronic
967116976 3:186350570-186350592 CATGTTCCTGCTTTCAATTTTGG + Intronic
967520762 3:190429644-190429666 CCTGTTCCTGCTCCATGTTTTGG - Exonic
967692275 3:192489671-192489693 CCTTTTGCTGCTTTGAATTTAGG + Intronic
969065098 4:4473250-4473272 CCTGTTCCTGCTTTCCACTTAGG + Intronic
971603414 4:28625328-28625350 ACTTTTCCTGCCTTTGGTTTTGG - Intergenic
971728073 4:30338720-30338742 CTTGTTAATGCTTTTAGTCTAGG - Intergenic
972140434 4:35952617-35952639 GCTTTTGCTGCTTTTGGTTTTGG - Intronic
972759503 4:42089297-42089319 TCTGTACCTACTTTTAGCTTTGG + Exonic
976364681 4:84220256-84220278 TTTGTTCCTGCTTTTACCTTTGG - Intergenic
976857848 4:89626383-89626405 CATGTTCCTCCTCTTACTTTCGG + Intergenic
977155273 4:93564755-93564777 TCTCTCCCTGCTTTTATTTTTGG - Intronic
978025898 4:103873864-103873886 ATTTTTCCTGCTTTTATTTTAGG + Intergenic
978154865 4:105477309-105477331 TCTGTTTCTGTTTTTAGTATTGG + Intergenic
980388857 4:132119969-132119991 CCTGGTCCAGCTTACAGTTTCGG + Intergenic
980530367 4:134045351-134045373 CCTGTTCCTACATTTCGGTTTGG + Intergenic
980778340 4:137464748-137464770 CATGTTCCTGCTCTTACTTTTGG + Intergenic
981128768 4:141134615-141134637 CTTGTGCCTGCTTCTAATTTGGG - Intronic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
982353028 4:154436975-154436997 CCTCTTCCTTCTTTTGGTGTGGG + Intronic
984302035 4:177933331-177933353 CTTCTTCTTGCTTTTTGTTTAGG + Intronic
984457893 4:179993943-179993965 CCACTTTCTGCTTTTAGTTCAGG - Intergenic
984924654 4:184796122-184796144 CCTCTGCCTGCTTTTAATTTTGG - Intronic
985216968 4:187663900-187663922 CATGTTCCTCCTCTTACTTTTGG - Intergenic
986497494 5:8359970-8359992 CTTGTCACTGCTTTTGGTTTAGG - Intergenic
986924458 5:12730172-12730194 CCTCTTCCAGCTTTCAGTTTAGG - Intergenic
987891918 5:23889916-23889938 CCTGTTTCTGGTTTTAATTGTGG - Intergenic
988849731 5:35168219-35168241 TCTATTTCTGCTTTTAGTCTTGG - Intronic
993387870 5:87281068-87281090 CCAGTGCCTGCTTTCATTTTGGG + Intronic
993917363 5:93759412-93759434 CCTTTTCCTGGTTTTGGTATTGG - Intronic
994635212 5:102337965-102337987 CATGTTCCTCCTCTTACTTTTGG - Intergenic
997285643 5:132676330-132676352 CCTGTTCTTGCTTTTAATCGTGG - Intronic
999745995 5:154592283-154592305 CCTGTTCTTACTTTAAGTTCTGG + Intergenic
1000383289 5:160648081-160648103 CTTGTTCCTGCTGTGAGTTAGGG + Intronic
1000685633 5:164245642-164245664 TCTGTTCCTGCTTTGAGGTTAGG - Intergenic
1002583456 5:180225217-180225239 CCTTTTCCTGCTTTAAGGTAAGG - Intergenic
1002804949 6:564364-564386 ACTGTTCCTGGTTTTTGTGTTGG - Intronic
1003261027 6:4516294-4516316 CCTTGTCCTGCTTTTAGAGTAGG - Intergenic
1006465619 6:34192536-34192558 CCTTTGCCTATTTTTAGTTTAGG - Intergenic
1007437369 6:41824706-41824728 CTTGTTCTTGTTTTTTGTTTTGG - Intronic
1009359970 6:62799360-62799382 CCTTTTCCTGGTTTTAGTATTGG + Intergenic
1010095621 6:72040317-72040339 CCTGTTATTGCTTTCACTTTAGG - Intronic
1010548970 6:77196753-77196775 CCTGTTCCTGTTGTTACTCTTGG + Intergenic
1010943408 6:81946961-81946983 CCAGTTCAGGATTTTAGTTTTGG + Intergenic
1012152310 6:95769710-95769732 CCTGTACCTGATTTTCTTTTAGG - Intergenic
1012562549 6:100601125-100601147 CCTGTTCCTGATTCAAGATTTGG + Intronic
1012938635 6:105394212-105394234 GTTATTCCTACTTTTAGTTTTGG - Intronic
1013246394 6:108291129-108291151 CCTGTTCCTTATTTTAGGCTTGG + Intergenic
1014849113 6:126318652-126318674 CTTTTTCCTGCTTGTACTTTAGG + Intergenic
1015370073 6:132440494-132440516 CGTGTTCCTCCTTTTACTTTCGG - Intergenic
1015408305 6:132862575-132862597 CTTGTTCCTACTTCTAATTTAGG + Intergenic
1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG + Intergenic
1016321856 6:142854990-142855012 ACTTTTTCTGCTTTTAGTTGAGG - Intronic
1017948703 6:159117669-159117691 CCAGTTCCTGCATTGAGTCTGGG + Intergenic
1018312109 6:162521246-162521268 CATGTGCTTGCTTATAGTTTTGG - Intronic
1018657911 6:166057594-166057616 CCTTTTTCTGCTTCTATTTTTGG - Intergenic
1018924454 6:168196711-168196733 CCTCTTCCTGCCTTTCCTTTGGG - Intergenic
1019840175 7:3434115-3434137 CCTGTTCTTGCTGGTAATTTTGG + Intronic
1020072759 7:5238396-5238418 CCTGTTGCTGCTTTTAGAAGTGG + Intergenic
1021047705 7:15943527-15943549 CTTCTTCCTGGTTTTAGTCTTGG - Intergenic
1023594234 7:41812104-41812126 TATGTTCCTGCTTTTGTTTTTGG + Intergenic
1026227385 7:68454542-68454564 CGTGTTCCTCCTCTTACTTTCGG + Intergenic
1028278422 7:88889051-88889073 CCTGTTCCTGAATTTTGCTTAGG + Intronic
1029150624 7:98477808-98477830 CCTGTCCCTGTTTTTTGTTTTGG - Intergenic
1029358482 7:100070681-100070703 CCTAGTCCAGCTTTAAGTTTCGG - Exonic
1031365248 7:120892987-120893009 CCTGTTCCTGCCTTAAATCTTGG + Intergenic
1031858817 7:126955110-126955132 CCTTTTCCTCATTTTTGTTTGGG - Intronic
1037120156 8:15274702-15274724 CCTGGTGCTGCTTTTTGTTTTGG - Intergenic
1038222234 8:25621666-25621688 CCTGTCACTGCTTCTAGTTGTGG - Intergenic
1039666631 8:39540519-39540541 CTTGTTTCTACTTTTACTTTAGG + Intergenic
1040720419 8:50314440-50314462 CCTGTTCCCTCTTTTACTCTAGG + Intronic
1042186298 8:66139510-66139532 CCTGTTCCTTCTTGTCATTTCGG - Intronic
1043047380 8:75343900-75343922 CCTGGCCCAGCTTCTAGTTTGGG - Intergenic
1044949581 8:97422541-97422563 CGTGTTCCTCCTCTTACTTTCGG + Intergenic
1046672876 8:117076630-117076652 CCTATTCCAGTTTTTAGGTTGGG + Intronic
1046772534 8:118130501-118130523 TTTCTTCCTGCTTTTAGTTGGGG - Intergenic
1047376262 8:124300429-124300451 CCTGTGGCTGCTTTTAGTTTGGG - Intergenic
1047516775 8:125561918-125561940 CCTTTTCCTCCTATTAATTTTGG - Intergenic
1048002529 8:130390945-130390967 CCAGATCCTGCTTTCAATTTTGG - Intronic
1050016469 9:1239262-1239284 CCTGTTTCTACTTTTATTTTAGG + Intergenic
1051001630 9:12290075-12290097 TCTGTTCTTGCTTTTAATTTAGG - Intergenic
1051104999 9:13569364-13569386 CCTGCACCTGCTTTCATTTTTGG + Intergenic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1051950788 9:22629789-22629811 CCTTGTCCTGCTTTTAATATTGG - Intergenic
1055286758 9:74737005-74737027 ACTGTTTGTGCTTTGAGTTTTGG - Intronic
1058189333 9:101893749-101893771 TTTCTTCCTGCTTTCAGTTTTGG + Intergenic
1058191539 9:101922867-101922889 ACATTACCTGCTTTTAGTTTTGG - Intergenic
1058836717 9:108863832-108863854 CCTACTCCTGCTTTTGTTTTGGG - Intergenic
1059058444 9:111009175-111009197 CCTGTTTCTATTTTTATTTTAGG - Intronic
1061030730 9:128080759-128080781 CCTGTTGTTGCTTTTGGTTAAGG + Intronic
1062676107 9:137745099-137745121 GCTATTCCTACTGTTAGTTTTGG - Intronic
1186046815 X:5545408-5545430 CCTTTTCCTGATTATACTTTTGG - Intergenic
1187028743 X:15463352-15463374 GCTTTTATTGCTTTTAGTTTAGG - Intronic
1187589862 X:20705584-20705606 CCAGTTCCTCCTTGTAGTTCTGG + Intergenic
1188005300 X:25012715-25012737 CCGGTTCGGGCTTTAAGTTTAGG - Intronic
1189109369 X:38271414-38271436 CCTGTTCCTTCTTTCTTTTTTGG - Intronic
1196047223 X:111269103-111269125 ACTTTTTCTGCTTTTAATTTAGG + Intronic
1196580041 X:117368074-117368096 TCTGTTCCAACTTTTATTTTAGG - Intergenic
1198681330 X:139185782-139185804 CCAGATCCTGACTTTAGTTTTGG - Intronic
1198947745 X:142033531-142033553 CCTGTACCTACTTTTATTCTGGG + Intergenic
1202242914 Y:22789051-22789073 TCTGATCCTGCTTTTCCTTTTGG - Intergenic
1202395901 Y:24422801-24422823 TCTGATCCTGCTTTTCCTTTTGG - Intergenic
1202474884 Y:25247291-25247313 TCTGATCCTGCTTTTCCTTTTGG + Intergenic