ID: 1051169341

View in Genome Browser
Species Human (GRCh38)
Location 9:14303418-14303440
Sequence ACAAAGGCAATATGGGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051169336_1051169341 26 Left 1051169336 9:14303369-14303391 CCTGGTTTTTGTTTGGTTTTGTT 0: 1
1: 39
2: 313
3: 904
4: 3372
Right 1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051169341 Original CRISPR ACAAAGGCAATATGGGGAAT AGG Intronic
No off target data available for this crispr