ID: 1051173832

View in Genome Browser
Species Human (GRCh38)
Location 9:14345072-14345094
Sequence TCCTGAGCTCGGCCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051173822_1051173832 17 Left 1051173822 9:14345032-14345054 CCCAGCTCCAGGGGTTCTGGGAG 0: 1
1: 0
2: 4
3: 31
4: 273
Right 1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG No data
1051173824_1051173832 10 Left 1051173824 9:14345039-14345061 CCAGGGGTTCTGGGAGTCCGTCT 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG No data
1051173823_1051173832 16 Left 1051173823 9:14345033-14345055 CCAGCTCCAGGGGTTCTGGGAGT 0: 1
1: 0
2: 0
3: 23
4: 239
Right 1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG No data
1051173827_1051173832 -7 Left 1051173827 9:14345056-14345078 CCGTCTTGGGCCACTCTCCTGAG 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051173832 Original CRISPR TCCTGAGCTCGGCCTCCCTG GGG Intronic
No off target data available for this crispr