ID: 1051173969

View in Genome Browser
Species Human (GRCh38)
Location 9:14345971-14345993
Sequence ACACCGCCATGGTGGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051173960_1051173969 15 Left 1051173960 9:14345933-14345955 CCTGCCTTTCTGGTTGACCCTCC No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data
1051173964_1051173969 -2 Left 1051173964 9:14345950-14345972 CCCTCCGCAGGGCTTTCTCTGAC No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data
1051173961_1051173969 11 Left 1051173961 9:14345937-14345959 CCTTTCTGGTTGACCCTCCGCAG No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data
1051173958_1051173969 26 Left 1051173958 9:14345922-14345944 CCTAGAAACTTCCTGCCTTTCTG No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data
1051173965_1051173969 -3 Left 1051173965 9:14345951-14345973 CCTCCGCAGGGCTTTCTCTGACA No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data
1051173966_1051173969 -6 Left 1051173966 9:14345954-14345976 CCGCAGGGCTTTCTCTGACACCG No data
Right 1051173969 9:14345971-14345993 ACACCGCCATGGTGGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051173969 Original CRISPR ACACCGCCATGGTGGCAACA TGG Intronic