ID: 1051174184

View in Genome Browser
Species Human (GRCh38)
Location 9:14347057-14347079
Sequence GACAACCCGCCCGGCGCGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051174175_1051174184 -3 Left 1051174175 9:14347037-14347059 CCCCTGGCCCCCACTCGGGAGAC 0: 1
1: 0
2: 1
3: 6
4: 146
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data
1051174170_1051174184 20 Left 1051174170 9:14347014-14347036 CCAGCGAAATCGCGGCCAGGGAG 0: 1
1: 0
2: 1
3: 0
4: 34
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data
1051174176_1051174184 -4 Left 1051174176 9:14347038-14347060 CCCTGGCCCCCACTCGGGAGACA 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data
1051174177_1051174184 -5 Left 1051174177 9:14347039-14347061 CCTGGCCCCCACTCGGGAGACAA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data
1051174178_1051174184 -10 Left 1051174178 9:14347044-14347066 CCCCCACTCGGGAGACAACCCGC 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data
1051174172_1051174184 5 Left 1051174172 9:14347029-14347051 CCAGGGAGCCCCTGGCCCCCACT 0: 1
1: 1
2: 3
3: 64
4: 588
Right 1051174184 9:14347057-14347079 GACAACCCGCCCGGCGCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051174184 Original CRISPR GACAACCCGCCCGGCGCGAA GGG Intronic
No off target data available for this crispr