ID: 1051174232

View in Genome Browser
Species Human (GRCh38)
Location 9:14347302-14347324
Sequence CCCGAAGGCACTGACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051174232_1051174248 25 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174248 9:14347350-14347372 CTCAAGGTTTGGACTCCTAGGGG No data
1051174232_1051174239 9 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174239 9:14347334-14347356 ACCGCGCGCTCCCACCCTCAAGG No data
1051174232_1051174249 28 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174249 9:14347353-14347375 AAGGTTTGGACTCCTAGGGGAGG No data
1051174232_1051174241 14 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174241 9:14347339-14347361 GCGCTCCCACCCTCAAGGTTTGG No data
1051174232_1051174247 24 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174247 9:14347349-14347371 CCTCAAGGTTTGGACTCCTAGGG No data
1051174232_1051174250 29 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174250 9:14347354-14347376 AGGTTTGGACTCCTAGGGGAGGG No data
1051174232_1051174245 23 Left 1051174232 9:14347302-14347324 CCTGCACAGTCAGTGCCTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1051174245 9:14347348-14347370 CCCTCAAGGTTTGGACTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051174232 Original CRISPR CCCGAAGGCACTGACTGTGC AGG (reversed) Intronic
900886146 1:5416916-5416938 CCCCAAGACTCTGTCTGTGCTGG - Intergenic
903269842 1:22180790-22180812 CCTAAAGACACTGTCTGTGCTGG + Intergenic
903374084 1:22854832-22854854 CCCAGAGGGACTGACTCTGCTGG + Intronic
904000562 1:27336234-27336256 CCTGATGGCACTGGCTGTGCTGG - Exonic
906130833 1:43454400-43454422 AGCGAAGGCACTGACTTTGAAGG - Intergenic
907272765 1:53300497-53300519 CCCGTAGGCACTGCCTGGGTCGG - Intronic
911195941 1:94995791-94995813 CCTGAATGCACTGACAGTGAAGG - Intronic
912385750 1:109270430-109270452 CAGGATGGCAATGACTGTGCAGG - Exonic
918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG + Intronic
919290813 1:195628039-195628061 CCCCAAGGCCCTGCCTGGGCAGG + Intergenic
924768012 1:247052334-247052356 CCAGAAGGCAGTGACTGTTATGG + Intronic
1066995028 10:42555413-42555435 TCAGATGGGACTGACTGTGCCGG + Intergenic
1076688389 10:132208382-132208404 GCCGAAAGGCCTGACTGTGCAGG + Intronic
1077058623 11:608057-608079 CCCGAAGGCCCAGACGGTGCAGG + Exonic
1079689972 11:23406072-23406094 CCCGCAGGCACAGACAGTGGCGG + Intergenic
1083763659 11:64832187-64832209 CCCCAAGGCTCTGACCCTGCAGG - Intronic
1084205143 11:67586746-67586768 CAGGAAGCCACTGACTGTGCTGG - Intergenic
1087810829 11:102607757-102607779 TCCGAAGGCAGTGACTTTCCAGG + Intronic
1088645692 11:111914351-111914373 CCAGAGGGCACTGTCTGAGCTGG + Intronic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1091033708 11:132214296-132214318 TCCAAAGGCACAGACTGGGCTGG - Intronic
1091413739 12:262066-262088 GTCTAAGGTACTGACTGTGCTGG + Intronic
1092989297 12:13879731-13879753 CAAGGAGGCACTGACTGTACCGG - Intronic
1095421467 12:42028616-42028638 CTCTAAGGCACAGATTGTGCTGG + Intergenic
1097885028 12:64720429-64720451 CCTGAAGGCACAGGGTGTGCAGG - Intronic
1102863845 12:116359007-116359029 CCAGAAGGGACTCACTGTCCTGG + Intergenic
1103446352 12:120997484-120997506 CACGCAGGCACAGAGTGTGCCGG + Exonic
1103601978 12:122060076-122060098 CCTTAAGGCACTGAGTGGGCCGG + Exonic
1104771974 12:131369266-131369288 CCGGATGGCACTCACGGTGCTGG - Intergenic
1112426102 13:99302736-99302758 CCAGGAGGCTCTGACTATGCTGG - Intronic
1118063322 14:62164348-62164370 CCATTAGGCACTGACTGTCCTGG - Intergenic
1120885666 14:89450024-89450046 TCCTAAGCCACTGACAGTGCTGG + Intronic
1121908794 14:97770492-97770514 CACAAAGGCAATAACTGTGCAGG + Intergenic
1123925927 15:25110598-25110620 CTATAAGGCACTGTCTGTGCTGG + Intergenic
1124625543 15:31305556-31305578 GCCACAGGCACTGGCTGTGCAGG + Intergenic
1128653103 15:69434735-69434757 CACGAACGCGCTGACTGGGCAGG + Intronic
1130567374 15:85008234-85008256 CCCTGAGCCACTGACTATGCAGG - Intronic
1135081190 16:19437360-19437382 CCCACAGGGACTGACTGTGTGGG + Intronic
1141998946 16:87653050-87653072 CCCGCAGGCACTGACTGGCTTGG - Intronic
1156453860 18:37281851-37281873 CCCGCAGGCAGTGACTCTGAGGG + Intronic
1162327165 19:10006196-10006218 CCTGAAGGCCCTGGGTGTGCAGG - Exonic
1163783639 19:19263181-19263203 CCCAAAGGCGCTCCCTGTGCAGG + Intergenic
1164685089 19:30161301-30161323 CGCCAAGGCAGTGACAGTGCAGG - Intergenic
1166560664 19:43730464-43730486 ACAGAAGGCACTGTCTGTACGGG + Exonic
1167014241 19:46829940-46829962 CCTGAAGGCACTGAGTGTCCAGG + Intergenic
925859358 2:8160048-8160070 TCCCAGGGCACTGACTGAGCAGG + Intergenic
926536473 2:14119271-14119293 CCAGAATTCAATGACTGTGCAGG - Intergenic
932817223 2:74871578-74871600 ACCGCACGCACTCACTGTGCAGG - Intronic
938246568 2:129781913-129781935 TCCGAGGGCACAGACGGTGCTGG - Intergenic
939765095 2:146238521-146238543 CCACAAAGCACTGGCTGTGCAGG + Intergenic
940860283 2:158764082-158764104 CCTGTAGGCACTGACTGAGTTGG + Intergenic
941584198 2:167336362-167336384 CCAGAAGGCACTTACTGTAATGG + Intergenic
941996858 2:171609417-171609439 CCCGAAGACTCTGATTGTCCTGG + Intergenic
942471614 2:176266753-176266775 CCCCAAGACACTGAATCTGCTGG + Intergenic
946249603 2:218404523-218404545 CCCCATGGCACTGAGTGTGGCGG - Exonic
946401288 2:219469590-219469612 CCCGTTAGCACTGACTGGGCAGG + Intronic
947835527 2:233172176-233172198 CCCAAAGGCACTGTCAGAGCAGG + Intronic
948461195 2:238130748-238130770 CACTCAGGCACTGCCTGTGCTGG - Exonic
948594494 2:239070874-239070896 CCCGAAAGGACTGAGTGTCCTGG + Intronic
1173229305 20:41181681-41181703 CCCTAGGCCACTGACTGAGCAGG + Exonic
1176055363 20:63142857-63142879 CCCTAAGGCACTGAGGGTCCTGG + Intergenic
1180706297 22:17812144-17812166 CCCTTAGGGACTGACTGTTCAGG - Intronic
1182049201 22:27300227-27300249 CCCGAACGCAATGACAGTGTGGG - Intergenic
1182124287 22:27805012-27805034 TCCGGGGGCACTGAGTGTGCTGG + Intergenic
954187389 3:48928232-48928254 CCCAAAGGCAATGACTATTCAGG - Intronic
958953208 3:100438757-100438779 GCAGCAGGCACTGACTGTGAGGG - Intronic
961173448 3:124815485-124815507 CCCAAAGGCCCTGACTCAGCAGG + Intronic
968138340 3:196235601-196235623 CCGGAAGGCAGTGGCTGCGCCGG + Exonic
968708608 4:2095966-2095988 ACAGAAGGCACTGTCAGTGCAGG + Intronic
976069873 4:81229251-81229273 CCCGAAGGCAATTACTATGCTGG + Intergenic
981819366 4:148868204-148868226 CCCCAAGGCACAAACTCTGCAGG - Intergenic
984296774 4:177862791-177862813 CACGAAGCCAGTGCCTGTGCCGG + Intronic
985891650 5:2720312-2720334 CCAGCAGGAACTGACTGTGCCGG + Intergenic
989094727 5:37771339-37771361 ACTAAAGGTACTGACTGTGCAGG + Intergenic
991459532 5:66843398-66843420 TCTGAAGGCACTAACTGTTCAGG - Intronic
996762380 5:126999367-126999389 CCCCAAGGGACAGGCTGTGCAGG - Intronic
997488266 5:134250242-134250264 TCCAAAGGCTCTGAGTGTGCAGG - Intergenic
999758850 5:154684809-154684831 CCATGAGGCACAGACTGTGCTGG - Intergenic
1001246141 5:170106730-170106752 CCAGAGGTCACTGACTGGGCAGG - Intronic
1001703004 5:173721087-173721109 TCCAGAGGCACTGACTGTGCAGG + Intergenic
1005362278 6:25042148-25042170 CCCGAAGGCAGCTGCTGTGCTGG + Intronic
1018800997 6:167222108-167222130 CCCGAAGGCCCAGACGGTGTGGG + Intergenic
1018809137 6:167285063-167285085 CCCGAAGGCCCAGACGGTGTGGG - Intronic
1019634486 7:2068232-2068254 CCCTCGGGCACTGACTGTGTGGG - Intronic
1024226192 7:47328283-47328305 TCTGGAGGCACTGACTGGGCAGG - Intronic
1030068107 7:105676118-105676140 CCCGAAGGACCTGAGTCTGCCGG + Intronic
1033452919 7:141477606-141477628 CCCCAAGGCCCTGAGTGAGCCGG - Exonic
1034541087 7:151758647-151758669 CCCGAAGGCACTGATAGACCTGG + Intronic
1035209667 7:157318497-157318519 CCAGAAGGAAGTGACTGTCCTGG - Intergenic
1035472022 7:159116407-159116429 CCCAAATGCACTGACCATGCGGG - Intronic
1038247048 8:25868253-25868275 CCAAAAGGCACATACTGTGCAGG - Intronic
1039169804 8:34730923-34730945 CCCTAAGGAACTGAGGGTGCTGG + Intergenic
1043502017 8:80867515-80867537 ACCGAGGGCACTGACTATGCAGG - Intronic
1048994699 8:139787188-139787210 CCCGCAGGCTGTGACTGTGCTGG - Intronic
1051174232 9:14347302-14347324 CCCGAAGGCACTGACTGTGCAGG - Intronic
1051762140 9:20479286-20479308 CCCCAAGGCAATTACTGTGAAGG + Intronic
1053397414 9:37787140-37787162 CCCGAAGGCGGTGGCTGGGCGGG + Intronic
1055954059 9:81757561-81757583 GGGGAAGGCTCTGACTGTGCTGG + Intergenic
1061485072 9:130916397-130916419 CCCCAAGTGACTGCCTGTGCCGG + Intronic
1186516142 X:10167225-10167247 CAGGAAGGCACTGACAGTGACGG - Intronic
1189247030 X:39571288-39571310 CCCTAAGGCAGAGAGTGTGCAGG - Intergenic
1191598435 X:62974184-62974206 CCAGAAGGGACTGTCTGTGGGGG + Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196733639 X:118965464-118965486 CTGGAAGGCACTGAGTGTTCTGG - Intergenic
1199229695 X:145422928-145422950 CCCCAAGTCACTTCCTGTGCTGG - Intergenic