ID: 1051175102

View in Genome Browser
Species Human (GRCh38)
Location 9:14352727-14352749
Sequence CTCCAATAACAGACAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051175098_1051175102 25 Left 1051175098 9:14352679-14352701 CCTCTAAGCTTTAGATTTCACTG 0: 1
1: 1
2: 0
3: 23
4: 155
Right 1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051175102 Original CRISPR CTCCAATAACAGACAGGGAA AGG Intronic
No off target data available for this crispr