ID: 1051175258

View in Genome Browser
Species Human (GRCh38)
Location 9:14353699-14353721
Sequence TCCCCGGGTCTCACCGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051175258_1051175267 27 Left 1051175258 9:14353699-14353721 CCGCAGGCGGTGAGACCCGGGGA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1051175267 9:14353749-14353771 GCCTTTTCTTCCATTTGCTAAGG No data
1051175258_1051175269 28 Left 1051175258 9:14353699-14353721 CCGCAGGCGGTGAGACCCGGGGA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1051175269 9:14353750-14353772 CCTTTTCTTCCATTTGCTAAGGG No data
1051175258_1051175264 -2 Left 1051175258 9:14353699-14353721 CCGCAGGCGGTGAGACCCGGGGA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1051175264 9:14353720-14353742 GACCAGCTGGAGGAGTCCACGGG No data
1051175258_1051175263 -3 Left 1051175258 9:14353699-14353721 CCGCAGGCGGTGAGACCCGGGGA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1051175263 9:14353719-14353741 GGACCAGCTGGAGGAGTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051175258 Original CRISPR TCCCCGGGTCTCACCGCCTG CGG (reversed) Intronic
901616150 1:10541379-10541401 TCTCCGGGACTCACTGCCAGTGG - Intronic
902368018 1:15990016-15990038 TCCCCGGGTCTGGCTGCATGAGG - Intergenic
903867774 1:26411302-26411324 TACTCGGGTCTCCCTGCCTGGGG + Intronic
914815344 1:151058805-151058827 TCTCCCGGTCCCACCGCCTCTGG + Exonic
919957993 1:202438441-202438463 TGCCAGGGTCCCACCGCTTGAGG + Intronic
924412358 1:243819492-243819514 TCCCTGGGACTCAGCCCCTGCGG + Intronic
924708022 1:246513735-246513757 TCCCCGGGTCTGGCTGCATGAGG + Intergenic
924756506 1:246946128-246946150 TCCCCGTGCCACACCGGCTGAGG + Intronic
1063657806 10:8009250-8009272 TCCCCGGGTCCCGCCGCCTCCGG + Exonic
1069311712 10:67045689-67045711 TCCCCCGCTATCCCCGCCTGGGG - Intronic
1069719492 10:70540631-70540653 TTCGCGGCTCTCACTGCCTGCGG + Intronic
1069769283 10:70887628-70887650 CCCCCAGGTCGCACAGCCTGCGG + Intronic
1070248630 10:74754152-74754174 TCCCCTGGCCTCCCAGCCTGGGG - Intergenic
1071136292 10:82458069-82458091 TCCCAGGCTCTCAGGGCCTGAGG - Intronic
1072234932 10:93445646-93445668 TCCCAGGCTCACAGCGCCTGTGG - Intronic
1073978966 10:109132239-109132261 TCCCTGGGTATCACCAGCTGAGG - Intergenic
1074315990 10:112362176-112362198 TTCCCTGGGCTCACAGCCTGGGG - Intergenic
1076664150 10:132076696-132076718 GCCCCGGGTCTTACCGTGTGAGG + Intergenic
1076664228 10:132076991-132077013 GCCCTGGGTCTTACCGCGTGAGG + Intergenic
1078987677 11:16610975-16610997 TCCCCGGAGCTCAGCGCCCGGGG - Intronic
1084603931 11:70161958-70161980 TCCCCGGTCCTCACTGCCTGGGG - Intronic
1084603960 11:70162034-70162056 TCCCCGGTCCTCACTGCCTGGGG - Intronic
1084604023 11:70162218-70162240 TCCCCGGTCCTCACTGCCTGGGG - Intronic
1084627438 11:70319259-70319281 TCCCTGCTTCTCACCACCTGCGG + Intronic
1084892752 11:72244450-72244472 TTCCCGGGCCTCCCCACCTGCGG + Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1097083299 12:56449104-56449126 TTCCCGGGTCTCACCGGACGCGG - Intronic
1097189990 12:57214989-57215011 TCCCCCTGTCTCTCCGCCTCTGG - Intergenic
1102016252 12:109649831-109649853 GCCCCGGGTCACACAGCCAGTGG - Intergenic
1103509414 12:121464461-121464483 TCCCCAAGTGTCACAGCCTGTGG - Intronic
1106264890 13:28100791-28100813 CCCCCGGGGCTCCCCGACTGCGG + Intergenic
1113951815 13:114076073-114076095 TCTCAGGGTCTCACTGCTTGCGG + Intronic
1116239720 14:42324976-42324998 TCCCAGGTTCTCTCAGCCTGGGG + Intergenic
1117314987 14:54565595-54565617 ACCTCGGGTCTCACCGCCCGGGG + Intergenic
1123031951 14:105456119-105456141 TGCCAGGGTCTCCCAGCCTGGGG + Intronic
1123055074 14:105565807-105565829 TCCCAGGGTCTCAGCTGCTGGGG + Intergenic
1123079522 14:105685651-105685673 TCCCAGGGTCTCAGCTGCTGGGG + Intergenic
1128454133 15:67823246-67823268 TCCCCGGGTCCGCCCGCCCGCGG - Intronic
1128883720 15:71265986-71266008 TCCCTGGGACAGACCGCCTGGGG + Intronic
1129974831 15:79813312-79813334 TGCCCGGGCCCCACCGCCTAGGG - Intergenic
1131313172 15:91309183-91309205 ACCCCGGGTGTGACCACCTGTGG - Intergenic
1132116008 15:99137046-99137068 TCCCCTGGTCCCACAGACTGTGG - Exonic
1132645524 16:997648-997670 TCCCCGGGCCTCACCACTTCAGG + Intergenic
1132663598 16:1072092-1072114 TCCCAGGCCCTCACTGCCTGGGG + Intergenic
1133597180 16:7304124-7304146 TCCCTGGCTCTCCCCGCCTGGGG - Intronic
1136185365 16:28585308-28585330 CCCCAGGATCTCACCACCTGAGG - Intronic
1136643491 16:31588663-31588685 CCCCCGGGACTGAACGCCTGAGG - Intergenic
1136913034 16:34159674-34159696 GCCCGGGATCTCACCGCCAGCGG - Intergenic
1139996890 16:70989733-70989755 TCTCCGGTTCTCCCCTCCTGAGG + Intronic
1140475872 16:75238989-75239011 CCCCTGGGCCTCACCGCGTGAGG - Intronic
1141958917 16:87391961-87391983 GCCCCGGGACACCCCGCCTGTGG + Exonic
1143580081 17:7820349-7820371 TTCCCGGGTCTGACTGCCAGTGG + Intronic
1145760805 17:27424684-27424706 TCCCCGGGTCTGACTGCATGAGG - Intergenic
1145760823 17:27424797-27424819 TCTCTGGGTCTGACCGCGTGAGG - Intergenic
1146313977 17:31792908-31792930 TGCCTGGGTCTCACCCCCAGAGG + Intergenic
1148745597 17:49916275-49916297 TCCCCAGCTCTCACCAGCTGGGG - Intergenic
1152717420 17:81906702-81906724 CCCCCGGGTCCCACCCCATGTGG + Intronic
1160024952 18:75209275-75209297 ACCCCGGGTGTCCCGGCCTGGGG + Exonic
1167677681 19:50897620-50897642 TTTCAGGGTCTCACCGCCTAAGG - Intergenic
1168259729 19:55186600-55186622 TCTCTGGGTCTCTCTGCCTGTGG - Intronic
925034069 2:672727-672749 TCCGCGAGTCCCACCGGCTGTGG + Intronic
925366233 2:3313976-3313998 TCCCCGGGTCCCAGCGGCTCAGG - Intronic
926059644 2:9797227-9797249 TCCCAGGGTCTGCCCTCCTGAGG + Intergenic
928218434 2:29382004-29382026 TCTCTGGGTCAGACCGCCTGTGG - Intronic
928893463 2:36234432-36234454 TCCCCGGGTCTCGCCCTCGGTGG + Intergenic
931349022 2:61471450-61471472 TCCCCGGGCCTCAGAGCCCGTGG - Intergenic
938537161 2:132256529-132256551 GCCTGGGGTCTCACCGCCAGTGG + Intronic
946408359 2:219504623-219504645 TCCCAGGGTCTTCCCTCCTGGGG + Intronic
946792611 2:223316549-223316571 AGCCTGGGTCTCTCCGCCTGAGG + Intergenic
947605720 2:231483986-231484008 GCTCCGGGTCTCAGCGTCTGCGG - Intergenic
948802521 2:240439344-240439366 TCTCAGGGTCTCCCAGCCTGAGG + Intronic
1171810630 20:29742717-29742739 GCCCGGGGTCTCACCGCCAGCGG + Intergenic
1173606185 20:44333421-44333443 GCCCCGGGTCACACATCCTGTGG - Intergenic
1173684061 20:44910328-44910350 TCCCCGGGGCTCACCGTCCGCGG - Exonic
1174575096 20:51531608-51531630 TCCCCAAGTCTCACAGCCGGGGG - Intronic
1178103764 21:29297783-29297805 TCCCCAAGTCCCACAGCCTGTGG + Intronic
1178680474 21:34669455-34669477 TCTCCGGGTCTCTCAGCCAGAGG - Exonic
1178711679 21:34922681-34922703 TCCCCAGGCCTCACCACCAGGGG - Intronic
1178924198 21:36761567-36761589 TCCCTGGTTGTCACAGCCTGAGG + Intronic
1179502030 21:41815982-41816004 TTCCCAGGTCTCACCGCTGGTGG - Intronic
1180342466 22:11629190-11629212 GCCCGGGATCTCACCGCCAGCGG - Intergenic
1185046858 22:48532953-48532975 TGCCAAGGTCCCACCGCCTGTGG + Intronic
951613989 3:24521917-24521939 TCCCCCGGGCCCGCCGCCTGCGG - Intergenic
954406626 3:50348839-50348861 TCCCTGGGTATCATCACCTGGGG - Intronic
960269459 3:115658565-115658587 CCCCAGGGTCTCAGCGGCTGAGG - Intronic
961493307 3:127271771-127271793 ACCCTGGGCCTCACCTCCTGAGG - Intergenic
961815655 3:129548872-129548894 TCCCTGCCTCTCACTGCCTGTGG + Intronic
962025524 3:131543076-131543098 TCCCAGGGTCTCACAGAATGAGG - Intronic
964454178 3:156842758-156842780 TCCCCTGGTCTCATCTCCTCAGG + Intronic
968081067 3:195847407-195847429 CCCCAGAGTCTCACCGCCTCTGG + Intergenic
968944885 4:3658399-3658421 TCCCAGGGTCGCAGTGCCTGGGG + Intergenic
969343674 4:6558071-6558093 GCCCCAAGTCTCACCGCCAGGGG - Intronic
969549623 4:7856007-7856029 TCCCAGGAGCCCACCGCCTGTGG - Intronic
979732797 4:124045186-124045208 TCCCCGGGACTGAGCCCCTGGGG - Intergenic
985491028 5:179567-179589 TGCCCAGGTCTCTCTGCCTGGGG - Intronic
985816509 5:2131929-2131951 TTGCGGAGTCTCACCGCCTGCGG + Intergenic
998521988 5:142809518-142809540 CCACCGGGACTCACTGCCTGGGG - Intronic
999300042 5:150485650-150485672 TTCCCGGGGGTCACCGCCTCGGG + Intergenic
1001489620 5:172146205-172146227 TCCCCGGGGAGCACCGGCTGTGG - Intronic
1002775461 6:324405-324427 TCCGCGGCACTCACTGCCTGAGG - Intronic
1002936887 6:1681611-1681633 TCCCCTGGCCTCTCTGCCTGGGG - Intronic
1006785084 6:36660949-36660971 CCTCCAGGTCACACCGCCTGAGG + Intergenic
1007251353 6:40497264-40497286 TCCCTGGTTCTCACCCACTGAGG + Intronic
1007496087 6:42261040-42261062 TCCCCGCGCCTCACCCCCAGGGG + Intronic
1012244619 6:96912535-96912557 ACCCCAAGTCTCACCGCCAGGGG - Intergenic
1020141805 7:5615783-5615805 TCCCCAGTTCTCACAGCCCGAGG + Intergenic
1029349596 7:100003825-100003847 ACCCCGAGTCTCACCCCCTCCGG + Intergenic
1033028529 7:137801729-137801751 TCCCCAGCTCTCACCCCCAGTGG - Intronic
1034063987 7:148119129-148119151 TCCCCGACTCTCACAGCCAGTGG - Intronic
1036787467 8:11697655-11697677 ACCCCGGGTCTTCGCGCCTGCGG + Intronic
1041395333 8:57384445-57384467 TCCCTGAGGCTCACAGCCTGGGG - Intergenic
1045320005 8:101075227-101075249 GCCCCAGGTCACACCGCCAGTGG - Intergenic
1051175258 9:14353699-14353721 TCCCCGGGTCTCACCGCCTGCGG - Intronic
1051358263 9:16259652-16259674 TCCCCGGGTCAGACTGCCTGTGG + Intronic
1051780559 9:20684344-20684366 CCGCCGGGTCGCGCCGCCTGCGG + Intronic
1053420125 9:37972113-37972135 TCCCCTGGACTGACCCCCTGTGG - Intronic
1055928343 9:81533567-81533589 ACCCCAGGTCTAACCACCTGAGG - Intergenic
1060749961 9:126162604-126162626 AGCCCGGGTGTCCCCGCCTGTGG + Intergenic
1062337293 9:136077654-136077676 TGCTCAGGTGTCACCGCCTGGGG - Intronic
1203361272 Un_KI270442v1:220661-220683 GCCCGGGGTCTCAACGCCAGCGG + Intergenic
1187266516 X:17738355-17738377 TCCCCGGCTCTCCCCGAGTGCGG + Intronic
1189231141 X:39453427-39453449 TCCCTGGGGCTCAGCTCCTGGGG - Intergenic
1189498508 X:41531334-41531356 TCCCCTGTTCTCACCCCCAGTGG + Intronic
1190217372 X:48488962-48488984 TCCCAGGGTCACACAGCCTGGGG - Intergenic
1197746020 X:129932518-129932540 TTCCCGGGTCGCTCCTCCTGCGG + Intergenic
1201077177 Y:10196899-10196921 GCCCAGGGTCTCACCACCAGCGG - Intergenic