ID: 1051179650

View in Genome Browser
Species Human (GRCh38)
Location 9:14396853-14396875
Sequence TGTGGTCTTTGAGCCATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051179646_1051179650 12 Left 1051179646 9:14396818-14396840 CCAGTATCATTCTCTGTAGCTGA 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1051179650 9:14396853-14396875 TGTGGTCTTTGAGCCATTAATGG No data
1051179644_1051179650 20 Left 1051179644 9:14396810-14396832 CCTGTGACCCAGTATCATTCTCT 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1051179650 9:14396853-14396875 TGTGGTCTTTGAGCCATTAATGG No data
1051179645_1051179650 13 Left 1051179645 9:14396817-14396839 CCCAGTATCATTCTCTGTAGCTG 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1051179650 9:14396853-14396875 TGTGGTCTTTGAGCCATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051179650 Original CRISPR TGTGGTCTTTGAGCCATTAA TGG Intronic
No off target data available for this crispr