ID: 1051179710

View in Genome Browser
Species Human (GRCh38)
Location 9:14397618-14397640
Sequence GACTTCATATGGTCTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051179710 Original CRISPR GACTTCATATGGTCTTGAAT AGG (reversed) Intronic
905834777 1:41108207-41108229 GACTTCATATGTTGTTAAACTGG - Intronic
907070360 1:51529023-51529045 GACTTCTTATGTTCATGAATTGG + Intergenic
907231364 1:53002231-53002253 GACTTCATAGGCTCTTAAATAGG - Intronic
907280253 1:53342450-53342472 TTCTTCATGTGGTCTTGCATGGG + Intergenic
909052627 1:70785209-70785231 GGCTTCAGATGTTATTGAATTGG - Intergenic
910300936 1:85707313-85707335 GACTTAATATGCTCTTTACTCGG - Intronic
910552423 1:88491087-88491109 GATGGCATATGGTCATGAATAGG + Intergenic
915500881 1:156316433-156316455 GACTTCACATGGCCATGAGTTGG - Intronic
923208859 1:231784968-231784990 GACTTCAGATGATCTTGTAAAGG - Intronic
923275613 1:232393145-232393167 GACTTCAGATGATCGTGAAGGGG - Intergenic
1063395398 10:5682816-5682838 GCCTTCTTCTGTTCTTGAATAGG + Intergenic
1067383740 10:45799338-45799360 GAAGTCATATTGTCTAGAATTGG + Intergenic
1067880443 10:50039454-50039476 GAAGTCATATTGTCTAGAATTGG - Intergenic
1067891438 10:50139913-50139935 GAAGTCATATTGTCTAGAATTGG + Intergenic
1069431630 10:68340720-68340742 AATTTCATATAGTCTTAAATAGG + Intronic
1072304100 10:94090336-94090358 AACATCATATGCTCTTGAAAAGG - Intronic
1074110146 10:110417146-110417168 GGCTTCAGCTGGTCTTGACTTGG + Intergenic
1076153339 10:128182455-128182477 GACTTAATATGTTCACGAATTGG - Intergenic
1076351664 10:129819400-129819422 GACTTAATATGTACCTGAATGGG + Intergenic
1076920308 10:133448987-133449009 GACATCCTATGTTCATGAATTGG + Intergenic
1077805584 11:5588547-5588569 GTCTTCATATGGTCTTGTTTGGG - Intronic
1078445212 11:11399105-11399127 GAATTCATGTGGTCATGAATGGG + Intronic
1081016161 11:37883600-37883622 GACTTCATATGTACTTTATTGGG + Intergenic
1085871306 11:80353017-80353039 GATTCCATATAGTCTAGAATTGG + Intergenic
1087915420 11:103804323-103804345 GCCTTCATATGGCCTTGATCTGG - Intergenic
1089936577 11:122370480-122370502 GATTTCATATGGTATATAATGGG + Intergenic
1090167500 11:124565908-124565930 TACTGAATATGTTCTTGAATAGG + Intergenic
1090626321 11:128611920-128611942 GACTTCATACTGTCTTAAAATGG + Intergenic
1090779338 11:129993430-129993452 GACTCCATATGGTGTTCTATTGG + Intronic
1098435313 12:70462474-70462496 GGCTTCATATTGTCTTTATTAGG - Intergenic
1104377870 12:128280912-128280934 GAGTTCATATGGGCTAGAAGTGG + Intronic
1105313338 13:19233530-19233552 GACATCCCATGGTCGTGAATTGG + Intergenic
1105318090 13:19287305-19287327 GACATCCCATGGTCATGAATTGG + Intergenic
1106744044 13:32680626-32680648 GACTTCTTTTGGTGTGGAATAGG + Intronic
1107007954 13:35636297-35636319 GACTTCAAATGGCTTTAAATAGG - Intronic
1111223070 13:85230756-85230778 AAATTCATATGGTCCAGAATGGG + Intergenic
1117171427 14:53103231-53103253 AACTTGATATGGTTTTCAATAGG + Intronic
1117825652 14:59700252-59700274 GATTTCTTATGTTCATGAATTGG + Intronic
1123015615 14:105373099-105373121 GATGTCATATGTTCATGAATTGG + Intronic
1129585598 15:76860976-76860998 GGCTTCTTATGGTATTTAATGGG - Intronic
1130230161 15:82090965-82090987 GACTTCATATGGTGAAAAATAGG - Intergenic
1131714984 15:95099144-95099166 GACTTCATATGCTTTTGTAGAGG - Intergenic
1136905905 16:34091966-34091988 ATCTTCATATGGAATTGAATGGG - Intergenic
1144939775 17:18930550-18930572 GACTTCATGTGGAATTGTATTGG - Exonic
1164478406 19:28592722-28592744 GAATTCATATGGTATTGGAGAGG - Intergenic
1167033818 19:46981123-46981145 AAATTCAAATGGTCTTGAAGAGG - Intronic
1168460185 19:56548305-56548327 GATTTCATATGATGTTAAATTGG - Intronic
925276599 2:2653505-2653527 GACTCCAGAGGGTGTTGAATAGG - Intergenic
930690196 2:54354455-54354477 GACATTCTATGCTCTTGAATAGG - Intronic
932977889 2:76625905-76625927 AACATCACATGGTCATGAATTGG - Intergenic
935886142 2:107621587-107621609 TACTCCATATGGTCTATAATGGG + Intergenic
938374058 2:130793572-130793594 GACATCTTATGTTCGTGAATTGG - Intergenic
938669409 2:133572704-133572726 GAGTTAATATGGTCAGGAATAGG + Intergenic
940040949 2:149360072-149360094 TACTTTATATGGTCTAAAATGGG - Intronic
941999751 2:171634036-171634058 GACTTGATCTGGTTTTGATTTGG + Intergenic
946635641 2:221722708-221722730 GACATCTCATGCTCTTGAATTGG - Intergenic
1169627703 20:7591110-7591132 GAATTGAAATGGTCTAGAATAGG - Intergenic
1170225658 20:13989103-13989125 GACTTCCCATGTTCATGAATTGG - Intronic
1170395038 20:15916670-15916692 GACTTCAGATGGTATTGGAAAGG - Intronic
1173189437 20:40864873-40864895 GACTTCTTTTGGTCTGCAATTGG - Intergenic
1173997865 20:47353211-47353233 GACTGCATCAGGTCTTAAATAGG - Intronic
1176529293 21:7945724-7945746 GACATCAAATGGAATTGAATGGG - Intergenic
1177334839 21:19709564-19709586 GATTTCATATATTCTTGAAAAGG - Intergenic
1177550089 21:22609507-22609529 GACATCTTATAGTATTGAATAGG + Intergenic
1182842398 22:33401967-33401989 GACTGCATATGGGGGTGAATGGG - Intronic
1183713010 22:39517490-39517512 GAGTTCAAATAGTCTTGAAGGGG + Exonic
949387643 3:3521182-3521204 GGCCTTATATGGTCTGGAATGGG - Intergenic
949502812 3:4698045-4698067 TACTTCATTTGGTTTTGCATTGG + Intronic
951480365 3:23154901-23154923 GACATCATATGCTCATGAATTGG + Intergenic
951800109 3:26586391-26586413 TACTTAATATGGTCTTTAAATGG - Intergenic
952735372 3:36685467-36685489 GACATCCTATGTTCATGAATTGG + Intergenic
952735453 3:36686957-36686979 GACATCATATGTTCATGAATTGG + Intergenic
953104797 3:39866699-39866721 GACTTCCTATGTTCTTGGATTGG + Intronic
953176245 3:40555276-40555298 GAGTTCATATTGTCTTTACTGGG - Intronic
957527565 3:81396612-81396634 TACTTCATATAGTCTTTAGTAGG + Intergenic
958692297 3:97483347-97483369 GACTGCATATAGTCCTGAATAGG - Intronic
960658817 3:120035600-120035622 GACATCCTATGTTCATGAATTGG - Intronic
961198107 3:125020704-125020726 GATTACAAATGGTCTTGAAGAGG + Intronic
963830081 3:149997890-149997912 GACATCATATGCTCATGAATTGG + Intronic
964297164 3:155246356-155246378 GAATTGATATTGTCTTGAATGGG - Intergenic
969065364 4:4475208-4475230 AACTTCATATGCTCTGTAATGGG + Intronic
970185004 4:13442902-13442924 GAATTGATGTGGTCTTGATTAGG + Intronic
973740269 4:53912669-53912691 GTCTTCATCTGGTCCTGAAGTGG - Intronic
975885740 4:78962613-78962635 GACTTCACTTGGATTTGAATAGG + Intergenic
979375706 4:119944181-119944203 AACTTCATATTGTCTTGGACAGG + Intergenic
980182000 4:129412769-129412791 GACTCCATATTCTCTTTAATTGG + Intergenic
980193021 4:129549848-129549870 GCCTACAGATTGTCTTGAATAGG - Intergenic
980770130 4:137361265-137361287 CACTTCAGATAGTCTTGAGTAGG + Intergenic
982371610 4:154639348-154639370 GAGTTCACATGGACCTGAATAGG + Intronic
982737867 4:159024972-159024994 TACTTCATAGGGTATTTAATGGG - Intronic
989435874 5:41412773-41412795 GACTTGATATTGTCTGGACTTGG + Intronic
991627159 5:68615290-68615312 GACTTCCCATGATCATGAATGGG + Intergenic
993264154 5:85699928-85699950 GTCTTCATAAGGTTTTGAATTGG - Intergenic
995180268 5:109224424-109224446 GCCCTCATATGGCCCTGAATGGG + Intergenic
996323482 5:122246147-122246169 ATCTCCATATGGTCTTGCATAGG + Intergenic
996507667 5:124286539-124286561 GGCTTCATATCCTCTTCAATGGG + Intergenic
997852132 5:137342525-137342547 GACTTTATTTGCTCCTGAATGGG - Intronic
999253812 5:150198413-150198435 CACTTCAGATGGACTTGAAGTGG - Intronic
1003523419 6:6878343-6878365 GATTTGATATGTTGTTGAATAGG + Intergenic
1004891567 6:20105842-20105864 TACATCATTTTGTCTTGAATTGG - Intronic
1008245979 6:49173560-49173582 GACTTCATATATAATTGAATTGG + Intergenic
1010365026 6:75040841-75040863 GACTTAATATGGCCTTGTATAGG + Intergenic
1011573860 6:88772297-88772319 GACATCATATGTTCATGGATAGG + Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018660566 6:166082689-166082711 GACATCCCATGCTCTTGAATTGG - Intergenic
1021318946 7:19187288-19187310 GACATCCTATGCTCTTGGATTGG + Intergenic
1021385648 7:20026592-20026614 TTCTTCATATGGTGTAGAATTGG + Intergenic
1022151069 7:27607166-27607188 GACATCTTATGGTCTTTAATTGG - Intronic
1023041717 7:36178523-36178545 GATTTCATATGGGCTTTAACTGG + Intronic
1023389708 7:39697663-39697685 GGATTCATTTGGTCTGGAATGGG + Intronic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1024250302 7:47501283-47501305 TTCTTCATATGGTCTTCACTAGG - Intronic
1024387207 7:48766308-48766330 GACTTCATATTGTTTGGATTCGG - Intergenic
1024451174 7:49544852-49544874 GACTTCTTATGGTATAAAATAGG - Intergenic
1031369951 7:120952646-120952668 GACTTCATAGAGTCTTTAAAAGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1035932979 8:3804995-3805017 CACTTCTTCTGGTCTTGAAGAGG + Intronic
1037706567 8:21320591-21320613 GACTAAATATTGTCTTGGATGGG + Intergenic
1038943685 8:32333538-32333560 GCATGGATATGGTCTTGAATCGG + Intronic
1049454555 8:142680453-142680475 GACTTTATATGGCCTCAAATGGG - Exonic
1051078861 9:13273060-13273082 GTCTTCATATGGTATGGAAGGGG - Intronic
1051096169 9:13467921-13467943 GACTTCCTATGTTCATTAATTGG + Intergenic
1051179710 9:14397618-14397640 GACTTCATATGGTCTTGAATAGG - Intronic
1053166038 9:35844484-35844506 GGCTTCATGTGGTCTTTTATGGG + Intronic
1057015843 9:91650754-91650776 GACATCCTATGTTCTTGGATTGG + Intronic
1061122184 9:128650336-128650358 TACTTCTTATGGGGTTGAATGGG - Intronic
1186653722 X:11590105-11590127 GATTTCTTATGGTCCTGAATCGG + Intronic
1186957798 X:14702213-14702235 GACTTCAGTTGCTCTTGAACTGG + Intronic
1187620836 X:21052522-21052544 GACATCTTGTGTTCTTGAATTGG + Intergenic
1192106626 X:68324029-68324051 GACTTCATCTGTGCTTTAATAGG - Intronic
1192338867 X:70245243-70245265 GTCTTCATATGGTCTTTCCTCGG + Intergenic
1196782712 X:119397860-119397882 GACTTTAAAAGGGCTTGAATTGG - Intergenic
1197246013 X:124167442-124167464 GAGTTCATATGGAATTGCATGGG - Intronic
1200972164 Y:9164219-9164241 GAGTTCATATGGGCTTCAGTAGG - Intergenic
1201609047 Y:15820234-15820256 AACTTCATACTGTGTTGAATAGG - Intergenic
1202138868 Y:21700094-21700116 GAGTTCATATGGGCTTAAGTAGG + Intergenic