ID: 1051180236

View in Genome Browser
Species Human (GRCh38)
Location 9:14404219-14404241
Sequence GCATTTTTGATAGCTGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051180236_1051180241 -2 Left 1051180236 9:14404219-14404241 CCCCTACCAGCTATCAAAAATGC No data
Right 1051180241 9:14404240-14404262 GCAAGAAGGAACAGAAGCATAGG No data
1051180236_1051180242 21 Left 1051180236 9:14404219-14404241 CCCCTACCAGCTATCAAAAATGC No data
Right 1051180242 9:14404263-14404285 TGAGCATATCTACCACCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051180236 Original CRISPR GCATTTTTGATAGCTGGTAG GGG (reversed) Intergenic
No off target data available for this crispr