ID: 1051181151

View in Genome Browser
Species Human (GRCh38)
Location 9:14413127-14413149
Sequence GATTTGTAATGAAACTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051181148_1051181151 8 Left 1051181148 9:14413096-14413118 CCATCATGCTCTGTGCTCTCTCC No data
Right 1051181151 9:14413127-14413149 GATTTGTAATGAAACTTATGAGG No data
1051181147_1051181151 9 Left 1051181147 9:14413095-14413117 CCCATCATGCTCTGTGCTCTCTC No data
Right 1051181151 9:14413127-14413149 GATTTGTAATGAAACTTATGAGG No data
1051181146_1051181151 13 Left 1051181146 9:14413091-14413113 CCTTCCCATCATGCTCTGTGCTC No data
Right 1051181151 9:14413127-14413149 GATTTGTAATGAAACTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051181151 Original CRISPR GATTTGTAATGAAACTTATG AGG Intergenic
No off target data available for this crispr