ID: 1051187901

View in Genome Browser
Species Human (GRCh38)
Location 9:14479974-14479996
Sequence AGGAAGAAGGAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051187893_1051187901 12 Left 1051187893 9:14479939-14479961 CCCTGGTTGGAAAAAAAGAAAGA No data
Right 1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG No data
1051187894_1051187901 11 Left 1051187894 9:14479940-14479962 CCTGGTTGGAAAAAAAGAAAGAA No data
Right 1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051187901 Original CRISPR AGGAAGAAGGAGAAGGAGGC AGG Intergenic
No off target data available for this crispr