ID: 1051190775

View in Genome Browser
Species Human (GRCh38)
Location 9:14509706-14509728
Sequence ATTTTGTCCTGGTGCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051190775_1051190780 -5 Left 1051190775 9:14509706-14509728 CCCCTGAAGCACCAGGACAAAAT No data
Right 1051190780 9:14509724-14509746 AAAATGGAGAAAGATAGAATAGG No data
1051190775_1051190781 -4 Left 1051190775 9:14509706-14509728 CCCCTGAAGCACCAGGACAAAAT No data
Right 1051190781 9:14509725-14509747 AAATGGAGAAAGATAGAATAGGG No data
1051190775_1051190782 18 Left 1051190775 9:14509706-14509728 CCCCTGAAGCACCAGGACAAAAT No data
Right 1051190782 9:14509747-14509769 GTCAGAAGACAGAGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051190775 Original CRISPR ATTTTGTCCTGGTGCTTCAG GGG (reversed) Intergenic
No off target data available for this crispr