ID: 1051192853

View in Genome Browser
Species Human (GRCh38)
Location 9:14533557-14533579
Sequence GCCTGTCCTGTCTGAGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051192853_1051192858 7 Left 1051192853 9:14533557-14533579 CCACAGTCTCAGACAGGACAGGC No data
Right 1051192858 9:14533587-14533609 GTAGCCTGACTCTGGGCTGGCGG No data
1051192853_1051192855 -1 Left 1051192853 9:14533557-14533579 CCACAGTCTCAGACAGGACAGGC No data
Right 1051192855 9:14533579-14533601 CGCTTAAGGTAGCCTGACTCTGG No data
1051192853_1051192857 4 Left 1051192853 9:14533557-14533579 CCACAGTCTCAGACAGGACAGGC No data
Right 1051192857 9:14533584-14533606 AAGGTAGCCTGACTCTGGGCTGG No data
1051192853_1051192856 0 Left 1051192853 9:14533557-14533579 CCACAGTCTCAGACAGGACAGGC No data
Right 1051192856 9:14533580-14533602 GCTTAAGGTAGCCTGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051192853 Original CRISPR GCCTGTCCTGTCTGAGACTG TGG (reversed) Intergenic
No off target data available for this crispr