ID: 1051192857

View in Genome Browser
Species Human (GRCh38)
Location 9:14533584-14533606
Sequence AAGGTAGCCTGACTCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051192853_1051192857 4 Left 1051192853 9:14533557-14533579 CCACAGTCTCAGACAGGACAGGC No data
Right 1051192857 9:14533584-14533606 AAGGTAGCCTGACTCTGGGCTGG No data
1051192850_1051192857 22 Left 1051192850 9:14533539-14533561 CCTGGGGAAACATGTCAGCCACA No data
Right 1051192857 9:14533584-14533606 AAGGTAGCCTGACTCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051192857 Original CRISPR AAGGTAGCCTGACTCTGGGC TGG Intergenic
No off target data available for this crispr