ID: 1051195102

View in Genome Browser
Species Human (GRCh38)
Location 9:14555644-14555666
Sequence TTCAGTTATCACTTCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195102_1051195112 20 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195112 9:14555687-14555709 GTGTTTTCCAGGAAGATATGGGG No data
1051195102_1051195113 23 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data
1051195102_1051195111 19 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195102_1051195109 9 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data
1051195102_1051195110 18 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195110 9:14555685-14555707 AAGTGTTTTCCAGGAAGATATGG No data
1051195102_1051195114 24 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195102_1051195107 -10 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195107 9:14555657-14555679 GATAACTGAATTGTCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195102 Original CRISPR TTCAGTTATCACTTCCTGGA GGG (reversed) Intergenic