ID: 1051195103

View in Genome Browser
Species Human (GRCh38)
Location 9:14555645-14555667
Sequence ATTCAGTTATCACTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195103_1051195109 8 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data
1051195103_1051195112 19 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195112 9:14555687-14555709 GTGTTTTCCAGGAAGATATGGGG No data
1051195103_1051195111 18 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195103_1051195114 23 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195103_1051195110 17 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195110 9:14555685-14555707 AAGTGTTTTCCAGGAAGATATGG No data
1051195103_1051195113 22 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195103 Original CRISPR ATTCAGTTATCACTTCCTGG AGG (reversed) Intergenic
No off target data available for this crispr