ID: 1051195104

View in Genome Browser
Species Human (GRCh38)
Location 9:14555648-14555670
Sequence ACAATTCAGTTATCACTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195104_1051195109 5 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data
1051195104_1051195111 15 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195104_1051195114 20 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195104_1051195113 19 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data
1051195104_1051195112 16 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195112 9:14555687-14555709 GTGTTTTCCAGGAAGATATGGGG No data
1051195104_1051195116 29 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195116 9:14555700-14555722 AGATATGGGGAGGGAGTCCCTGG No data
1051195104_1051195110 14 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195110 9:14555685-14555707 AAGTGTTTTCCAGGAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195104 Original CRISPR ACAATTCAGTTATCACTTCC TGG (reversed) Intergenic
No off target data available for this crispr