ID: 1051195107

View in Genome Browser
Species Human (GRCh38)
Location 9:14555657-14555679
Sequence GATAACTGAATTGTCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195102_1051195107 -10 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195107 9:14555657-14555679 GATAACTGAATTGTCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195107 Original CRISPR GATAACTGAATTGTCCAAAG GGG Intergenic
No off target data available for this crispr