ID: 1051195109

View in Genome Browser
Species Human (GRCh38)
Location 9:14555676-14555698
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195103_1051195109 8 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data
1051195102_1051195109 9 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data
1051195104_1051195109 5 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195109 9:14555676-14555698 GGGGTGAACAAGTGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195109 Original CRISPR GGGGTGAACAAGTGTTTTCC AGG Intergenic