ID: 1051195111

View in Genome Browser
Species Human (GRCh38)
Location 9:14555686-14555708
Sequence AGTGTTTTCCAGGAAGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195102_1051195111 19 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195104_1051195111 15 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195103_1051195111 18 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data
1051195108_1051195111 -8 Left 1051195108 9:14555671-14555693 CCAAAGGGGTGAACAAGTGTTTT No data
Right 1051195111 9:14555686-14555708 AGTGTTTTCCAGGAAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195111 Original CRISPR AGTGTTTTCCAGGAAGATAT GGG Intergenic
No off target data available for this crispr