ID: 1051195113

View in Genome Browser
Species Human (GRCh38)
Location 9:14555690-14555712
Sequence TTTTCCAGGAAGATATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195104_1051195113 19 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data
1051195108_1051195113 -4 Left 1051195108 9:14555671-14555693 CCAAAGGGGTGAACAAGTGTTTT No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data
1051195103_1051195113 22 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data
1051195102_1051195113 23 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195113 9:14555690-14555712 TTTTCCAGGAAGATATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195113 Original CRISPR TTTTCCAGGAAGATATGGGG AGG Intergenic
No off target data available for this crispr