ID: 1051195114

View in Genome Browser
Species Human (GRCh38)
Location 9:14555691-14555713
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195102_1051195114 24 Left 1051195102 9:14555644-14555666 CCCTCCAGGAAGTGATAACTGAA No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195104_1051195114 20 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195108_1051195114 -3 Left 1051195108 9:14555671-14555693 CCAAAGGGGTGAACAAGTGTTTT No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data
1051195103_1051195114 23 Left 1051195103 9:14555645-14555667 CCTCCAGGAAGTGATAACTGAAT No data
Right 1051195114 9:14555691-14555713 TTTCCAGGAAGATATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195114 Original CRISPR TTTCCAGGAAGATATGGGGA GGG Intergenic