ID: 1051195116

View in Genome Browser
Species Human (GRCh38)
Location 9:14555700-14555722
Sequence AGATATGGGGAGGGAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051195108_1051195116 6 Left 1051195108 9:14555671-14555693 CCAAAGGGGTGAACAAGTGTTTT No data
Right 1051195116 9:14555700-14555722 AGATATGGGGAGGGAGTCCCTGG No data
1051195104_1051195116 29 Left 1051195104 9:14555648-14555670 CCAGGAAGTGATAACTGAATTGT No data
Right 1051195116 9:14555700-14555722 AGATATGGGGAGGGAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051195116 Original CRISPR AGATATGGGGAGGGAGTCCC TGG Intergenic
No off target data available for this crispr