ID: 1051197734

View in Genome Browser
Species Human (GRCh38)
Location 9:14581570-14581592
Sequence TTGAATAAGAGTGGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051197734_1051197741 3 Left 1051197734 9:14581570-14581592 CCAGCCTCCCCACTCTTATTCAA No data
Right 1051197741 9:14581596-14581618 ACTACCGGAAGTCCTAGCCAGGG No data
1051197734_1051197744 12 Left 1051197734 9:14581570-14581592 CCAGCCTCCCCACTCTTATTCAA No data
Right 1051197744 9:14581605-14581627 AGTCCTAGCCAGGGCAATCAGGG No data
1051197734_1051197740 2 Left 1051197734 9:14581570-14581592 CCAGCCTCCCCACTCTTATTCAA No data
Right 1051197740 9:14581595-14581617 TACTACCGGAAGTCCTAGCCAGG No data
1051197734_1051197743 11 Left 1051197734 9:14581570-14581592 CCAGCCTCCCCACTCTTATTCAA No data
Right 1051197743 9:14581604-14581626 AAGTCCTAGCCAGGGCAATCAGG 0: 33
1: 800
2: 8607
3: 10014
4: 5053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051197734 Original CRISPR TTGAATAAGAGTGGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr