ID: 1051199222

View in Genome Browser
Species Human (GRCh38)
Location 9:14598114-14598136
Sequence GCCCAGAGCAAGCTGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051199215_1051199222 5 Left 1051199215 9:14598086-14598108 CCTCTCTGGCCCACTGCCTCCAC No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199209_1051199222 21 Left 1051199209 9:14598070-14598092 CCCAAGGGCCCACCGACCTCTCT No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199212_1051199222 13 Left 1051199212 9:14598078-14598100 CCCACCGACCTCTCTGGCCCACT No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199216_1051199222 -4 Left 1051199216 9:14598095-14598117 CCCACTGCCTCCACAACCAGCCC No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199217_1051199222 -5 Left 1051199217 9:14598096-14598118 CCACTGCCTCCACAACCAGCCCA No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199210_1051199222 20 Left 1051199210 9:14598071-14598093 CCAAGGGCCCACCGACCTCTCTG No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199214_1051199222 9 Left 1051199214 9:14598082-14598104 CCGACCTCTCTGGCCCACTGCCT No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199213_1051199222 12 Left 1051199213 9:14598079-14598101 CCACCGACCTCTCTGGCCCACTG No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data
1051199208_1051199222 28 Left 1051199208 9:14598063-14598085 CCAAAGGCCCAAGGGCCCACCGA No data
Right 1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051199222 Original CRISPR GCCCAGAGCAAGCTGCCTGG AGG Intergenic
No off target data available for this crispr