ID: 1051200674

View in Genome Browser
Species Human (GRCh38)
Location 9:14618951-14618973
Sequence ATGTCTAAACAGATGGATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051200674_1051200681 8 Left 1051200674 9:14618951-14618973 CCACCATCCATCTGTTTAGACAT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1051200681 9:14618982-14619004 AAGTGGTAGGGAACTCGCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 76
1051200674_1051200678 -9 Left 1051200674 9:14618951-14618973 CCACCATCCATCTGTTTAGACAT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1051200678 9:14618965-14618987 TTTAGACATGATTGGCAAAGTGG 0: 1
1: 0
2: 0
3: 20
4: 147
1051200674_1051200680 -4 Left 1051200674 9:14618951-14618973 CCACCATCCATCTGTTTAGACAT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1051200680 9:14618970-14618992 ACATGATTGGCAAAGTGGTAGGG 0: 1
1: 1
2: 0
3: 8
4: 144
1051200674_1051200679 -5 Left 1051200674 9:14618951-14618973 CCACCATCCATCTGTTTAGACAT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1051200679 9:14618969-14618991 GACATGATTGGCAAAGTGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 113
1051200674_1051200682 26 Left 1051200674 9:14618951-14618973 CCACCATCCATCTGTTTAGACAT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1051200682 9:14619000-14619022 AGTGGTTGCCTCTGCCTGAAAGG 0: 1
1: 0
2: 2
3: 33
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051200674 Original CRISPR ATGTCTAAACAGATGGATGG TGG (reversed) Exonic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900883527 1:5399461-5399483 ATGTTTGGATAGATGGATGGTGG + Intergenic
901004130 1:6163478-6163500 ATGTCAAAACAGCTGGATGCAGG - Intronic
903829647 1:26166935-26166957 ATGTCTACACAGAGGCATGCAGG + Intergenic
905471238 1:38193611-38193633 AAGCCTGAACATATGGATGGAGG - Intergenic
906658021 1:47562787-47562809 AGGCATAAAGAGATGGATGGTGG - Intergenic
908045779 1:60166984-60167006 TTGTCTGACTAGATGGATGGTGG - Intergenic
908786226 1:67736946-67736968 ATGTGTAAACTGAGGGTTGGAGG + Intronic
909754263 1:79203797-79203819 ATGTCTAAAGAGAAGGATCAGGG + Intergenic
912573629 1:110643781-110643803 ATATCTAAAAATATGTATGGAGG + Intergenic
916420835 1:164636214-164636236 AGGTCTACAGAGATGGAAGGGGG + Intronic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
916635556 1:166664368-166664390 ATCTCTAGCCAGATGCATGGAGG + Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918586916 1:186198788-186198810 ATGTCTGAAAAAATGGATGGTGG + Intergenic
919149289 1:193674656-193674678 TTGTCTACATAGATGGTTGGTGG + Intergenic
919922262 1:202173594-202173616 ATAGCTAACCAGATGGAAGGAGG - Intergenic
924751028 1:246890255-246890277 AAGTCTAACTACATGGATGGGGG + Intronic
1063748843 10:8918959-8918981 ATCTATAAACATATGGATTGAGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064273606 10:13886764-13886786 AAGTCTAAACAGATCCATGTTGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064742791 10:18450436-18450458 ATGTCGAAACAGTGTGATGGGGG + Intronic
1065654121 10:27929003-27929025 ATGGCTAAACATATGGATTCTGG - Intronic
1067249345 10:44574149-44574171 ATCTCTAAACAGCTGAATGAAGG - Intergenic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1070535500 10:77374375-77374397 ATTACCAAACTGATGGATGGAGG - Intronic
1071307505 10:84312083-84312105 GTGTCTAAACATATGGAGAGAGG - Intergenic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1072818150 10:98530145-98530167 ATTTCTAGACAGATGTATGGAGG + Intronic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1074425282 10:113345419-113345441 ATGTCTAAACAGTCAGATGTTGG - Intergenic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075794449 10:125109166-125109188 TTCTCTAAACAGAAGGATGTGGG - Intronic
1077280599 11:1743396-1743418 ATGGATAGACGGATGGATGGAGG + Intronic
1078475327 11:11624299-11624321 ATTGCTAAACAGCAGGATGGAGG - Intergenic
1080781502 11:35433884-35433906 ATGGATAGACAGATGGGTGGGGG + Intronic
1080832320 11:35907095-35907117 ACATCTAAACACAGGGATGGGGG + Intergenic
1081092806 11:38894037-38894059 ATGTCTAACACAATGGATGGCGG + Intergenic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1085445343 11:76597543-76597565 AATACTAAGCAGATGGATGGTGG - Intergenic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1087292829 11:96339184-96339206 ATGTCTCAGGAGATGGCTGGTGG + Intronic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087902862 11:103662220-103662242 ATGTCTAAGCAGTTAGTTGGGGG - Intergenic
1094017220 12:25878187-25878209 AGTTCTAAGCATATGGATGGGGG - Intergenic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1096599212 12:52717606-52717628 CTGTCTAGGCAGATTGATGGGGG + Intergenic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1103000835 12:117384311-117384333 ATGTCAGCACTGATGGATGGAGG - Intronic
1104297433 12:127529645-127529667 ATGTCTGAATGGATGCATGGAGG + Intergenic
1105978293 13:25492998-25493020 ATGTCTAAACAAATGAATTTTGG - Intronic
1106887989 13:34211011-34211033 ATTTCTAAACAAATGCCTGGTGG + Intergenic
1111543598 13:89700749-89700771 AATTCTACACAGATGGATGTGGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113126875 13:106988987-106989009 ATGACTACACAGTTGGATAGTGG - Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113680683 13:112242219-112242241 AAGTAAAAACAGAGGGATGGAGG + Intergenic
1120102241 14:80458583-80458605 ATGTCTGAACAGATGAAGAGGGG - Intergenic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1126383891 15:48074473-48074495 ATGTCCAAAGAGAAGGTTGGGGG - Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1130827365 15:87563087-87563109 ATTTCTATAGAAATGGATGGGGG - Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1134488437 16:14677760-14677782 ATGGCTGGATAGATGGATGGTGG + Intronic
1136770474 16:32835012-32835034 ATCTCAAAAAGGATGGATGGGGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138244031 16:55453085-55453107 ATGGATAAAGGGATGGATGGAGG - Intronic
1138936065 16:61725086-61725108 ATGTCTAAACAGATCATTAGAGG + Intronic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1203072895 16_KI270728v1_random:1097118-1097140 ATCTCAAAAAGGATGGATGGGGG - Intergenic
1142907166 17:3051688-3051710 ATGTCTAATCAGGTGCATGCTGG + Intergenic
1142927402 17:3252568-3252590 ATGTCTAATCAGGTGCATGCTGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1155091346 18:22514782-22514804 GTGTCCAAACTGATGGAAGGAGG - Intergenic
1155637395 18:27972097-27972119 ATGCCTAGACAGAAGGATGGGGG - Intronic
1156154412 18:34284565-34284587 ATGTCTAAACACCTGTATGTAGG + Intergenic
1156949389 18:42875502-42875524 ATGTGGAAACAGATGCTTGGTGG + Intronic
1158135843 18:54207247-54207269 ATGTCTTTCCAGATGGAAGGAGG + Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1160094162 18:75855968-75855990 ATGGGCAGACAGATGGATGGCGG - Intergenic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1163238393 19:16043273-16043295 ATGAATAAACGAATGGATGGAGG + Intergenic
1163238428 19:16043404-16043426 ATGAATAAACGAATGGATGGAGG + Intergenic
1163382631 19:16978931-16978953 ATGGATAAATGGATGGATGGTGG - Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163837283 19:19582556-19582578 AGCTCTCAGCAGATGGATGGGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1168394345 19:56035538-56035560 TTGTCGGAAAAGATGGATGGAGG + Intronic
929271778 2:39980811-39980833 ATGTCAAGTCAAATGGATGGTGG + Intergenic
929477547 2:42267019-42267041 ATGTTTAAACACATGGATTTTGG + Intronic
930118920 2:47743950-47743972 ATGTCTAGGCAGATGGAGGTGGG + Intronic
931428601 2:62192673-62192695 TTCTTTAACCAGATGGATGGTGG - Intergenic
932122663 2:69115851-69115873 ATGTCTAAGGAAAAGGATGGTGG + Intronic
932310115 2:70732944-70732966 ATGTATGAACAGACAGATGGAGG - Intronic
933437167 2:82262805-82262827 ATGTCAAAACACATGCATAGAGG + Intergenic
934038872 2:88111157-88111179 ATGTCGAAAGAGCTGGCTGGGGG + Exonic
934726934 2:96628050-96628072 ATGTCATAACAGAAGGGTGGTGG + Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
936523065 2:113224242-113224264 ATGAATTAAAAGATGGATGGAGG + Intronic
938239515 2:129732544-129732566 CTATCTAAACAGATAAATGGAGG + Intergenic
938759343 2:134409915-134409937 ATTTCTACACAGAGGGATTGTGG - Intronic
941543242 2:166813686-166813708 ATGTGTAGACAGATAGATGTGGG + Intergenic
942860510 2:180604482-180604504 ATGTATAAACTGTTGGATGTGGG + Intergenic
942871753 2:180742701-180742723 ATATTTAAACAGAGGCATGGAGG - Intergenic
946952364 2:224891056-224891078 ATGTCTAGAAGGATGGATGATGG + Intronic
947361046 2:229345637-229345659 AGGTCTAAATGGATGGGTGGGGG + Intergenic
1169333192 20:4732587-4732609 AAGTCTGAAAGGATGGATGGAGG + Exonic
1171125101 20:22595824-22595846 CCTTCTAAAAAGATGGATGGAGG - Intergenic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173531277 20:43771628-43771650 ATGTGTAGACATATGGCTGGAGG - Intergenic
1174441873 20:50562155-50562177 ATGTCTAAAGACCTGGAAGGGGG - Intronic
1177046360 21:16174648-16174670 ATCTCTATACAGATAGATAGAGG - Intergenic
1178747448 21:35266638-35266660 ATGTCTTGGCAGATGGATGTAGG - Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1182814183 22:33144875-33144897 ATTGCTAAACAGATGGCAGGAGG + Intergenic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184996801 22:48213159-48213181 ATGGCTAGATGGATGGATGGGGG - Intergenic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
949454206 3:4221292-4221314 ATGTGGACACTGATGGATGGAGG + Intronic
949807256 3:7969234-7969256 ATGGCTATATACATGGATGGGGG + Intergenic
950202140 3:11052442-11052464 ATGGCAAAACAGATAGATGGAGG + Intergenic
950601599 3:14040298-14040320 ATCCCTAAGCAGATGTATGGTGG - Intronic
950715806 3:14846983-14847005 ATCACAAAACAGAGGGATGGAGG - Intronic
951519142 3:23594927-23594949 ATTTTTAAAAAGATGGATGAGGG - Intergenic
951985737 3:28618811-28618833 ATGTCTAAACAGTTATATGAGGG + Intergenic
952070252 3:29625773-29625795 CTGTCAAAGCTGATGGATGGTGG - Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
953422354 3:42764338-42764360 AAGTCCATTCAGATGGATGGGGG + Intronic
954828680 3:53399244-53399266 ATGGATTAATAGATGGATGGAGG - Intergenic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
957618570 3:82566117-82566139 ATGTTAAAACAGATGGATACTGG + Intergenic
960739754 3:120820135-120820157 ATGTCAAAACAGAGAGCTGGAGG + Intergenic
963485194 3:145927090-145927112 ATGTCTACAGAGATGGATGAGGG + Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
966305358 3:178527008-178527030 ATGTCTACATATATGAATGGCGG - Intronic
967352980 3:188534781-188534803 ATCTCTAGACAGAAGGTTGGAGG + Intronic
968557669 4:1255848-1255870 AGTTCTATACAGATGCATGGTGG - Intergenic
968610282 4:1553961-1553983 ATGTCTGAACAAAAGGGTGGAGG - Intergenic
969974645 4:11086007-11086029 CTGACCAAACAGATGAATGGAGG - Intergenic
970607691 4:17695791-17695813 ATGTCTAATTAGATAGATAGAGG + Intronic
972217127 4:36909851-36909873 ATCTCTGAGCAGATGTATGGTGG + Intergenic
974677515 4:65112576-65112598 ATGTAAAAACAGATGGCTGATGG + Intergenic
974938411 4:68435030-68435052 ATTTCTAAACTGATAGCTGGCGG + Intergenic
977163708 4:93669695-93669717 ATTTTCAAAGAGATGGATGGGGG + Intronic
979129549 4:117024726-117024748 AGTTCCAAACAGATGGATGAAGG - Intergenic
981054012 4:140341108-140341130 ATGTCTATCCTAATGGATGGGGG - Intronic
981075320 4:140585579-140585601 ATAACTAAACAGAGGGATGGAGG - Intergenic
981118613 4:141021528-141021550 ATGTCTAAACAGCTAAGTGGAGG - Intronic
981398962 4:144289243-144289265 AAGTTTAAAAAGATGTATGGTGG + Intergenic
981757079 4:148152379-148152401 ATTTCTAAACAGATGTACGTTGG - Intronic
982238469 4:153274390-153274412 TTGTTTAAATAAATGGATGGAGG + Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
985103334 4:186479103-186479125 ATCACTAAACAGCAGGATGGGGG + Intronic
987477386 5:18408415-18408437 AGGTATAAACTGGTGGATGGGGG - Intergenic
988312117 5:29573289-29573311 ATTTCTAAAGAGATGCATGAAGG + Intergenic
990213392 5:53504726-53504748 AAGTCTGAACAGAGGGGTGGTGG - Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
996151046 5:120035215-120035237 ATGTGGAAACAGAGAGATGGGGG - Intergenic
997513996 5:134472713-134472735 ATGTCAAAACAGTTCAATGGGGG - Intergenic
999639278 5:153655356-153655378 ATGAGTTAATAGATGGATGGTGG - Intronic
1000139675 5:158389956-158389978 ATGCCTAGCCAGATTGATGGTGG + Intergenic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001745766 5:174091168-174091190 GTGTCTAGACAGACGGTTGGCGG + Intronic
1003972587 6:11313350-11313372 ATGGCTGAGTAGATGGATGGTGG + Intronic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005287280 6:24341533-24341555 AGTTCAAAACAGATGGATGGAGG - Intronic
1005449248 6:25956969-25956991 AAGTCTATTCAGATGGTTGGGGG + Intergenic
1005506335 6:26472025-26472047 ATGTCAATAAATATGGATGGTGG + Intronic
1006212905 6:32412550-32412572 TTGTCTAGACTGAAGGATGGAGG - Intergenic
1006558799 6:34891021-34891043 ATTTCTAAATAAATGGATGGTGG + Intronic
1015292654 6:131555644-131555666 ATCTCTAATGAGATTGATGGGGG - Intergenic
1016548598 6:145251947-145251969 AAATCAAAACAGATAGATGGAGG - Intergenic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1017780904 6:157714553-157714575 GTGTCTACACTGATGGATGTTGG + Intronic
1018155564 6:160982412-160982434 AAGTCCAATCAGATGGTTGGGGG - Intergenic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1031138806 7:117918659-117918681 ATGTCTGAGAACATGGATGGGGG + Intergenic
1031882355 7:127211444-127211466 ATGCCCACACAGATGGAGGGTGG + Intronic
1033594077 7:142841970-142841992 ATGTGCAAACTGATGTATGGAGG - Intergenic
1034441815 7:151089489-151089511 AAGTCTAAACAGAGTGAGGGAGG - Intronic
1035563709 8:627786-627808 ATGACCACACAGTTGGATGGAGG - Intronic
1036382114 8:8242956-8242978 AAGTCTATTCAGATGGTTGGGGG - Intergenic
1037579578 8:20236586-20236608 ATGTCTACACAGTTGGCTGTGGG + Intergenic
1041181839 8:55257343-55257365 ATTTCTAAAGAGAAAGATGGAGG + Intronic
1041334959 8:56771904-56771926 ATATCTAAACATATGCTTGGAGG + Intergenic
1042985011 8:74573834-74573856 AAGGCTAAAGACATGGATGGAGG - Intergenic
1044765810 8:95572614-95572636 AGCTCTCAGCAGATGGATGGGGG - Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1048463731 8:134644245-134644267 ATGACTAAAGAGATGGAAAGGGG + Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1049970719 9:819783-819805 ATTTAAAAACGGATGGATGGTGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1052214986 9:25955402-25955424 CTGTCTAAAAAGATAAATGGAGG + Intergenic
1053806547 9:41807901-41807923 ATGTCAAAACAGATATATGAGGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1058319818 9:103615003-103615025 ATGTCTAACCCTATGGATTGAGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059788850 9:117617887-117617909 ATGTCCAAACAAAGGCATGGAGG - Intergenic
1060010335 9:120038186-120038208 CTATATAAACAAATGGATGGTGG - Intergenic
1062092388 9:134685251-134685273 ATGACTTAATGGATGGATGGTGG - Intronic
1062112300 9:134788765-134788787 ATGAGTAGACAGGTGGATGGTGG + Intronic
1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG + Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1189188104 X:39071263-39071285 AGGTCTATTCAGATGGTTGGGGG + Intergenic
1189327253 X:40120366-40120388 ATGTATAACCAGGTGGTTGGTGG - Intronic
1190498309 X:51049217-51049239 AAGTCCAATCAGATGGTTGGGGG + Intergenic
1190552959 X:51603626-51603648 ATGTCTGAGGAAATGGATGGGGG - Intergenic
1190662343 X:52666453-52666475 ACGTCTATTCAGATGGTTGGGGG - Intronic
1191127761 X:56975619-56975641 ATGTCCATTCAGATGGTTGGGGG + Intergenic
1196906902 X:120446230-120446252 AAGTCTAAATAGTTGCATGGGGG - Intronic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic
1202198474 Y:22321964-22321986 ATACCTCAACAGATTGATGGAGG - Intronic