ID: 1051205325

View in Genome Browser
Species Human (GRCh38)
Location 9:14682614-14682636
Sequence CAACATTAGATCAACGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051205323_1051205325 16 Left 1051205323 9:14682575-14682597 CCCACACAATAATAATGGGAGAC 0: 3588
1: 5382
2: 2493
3: 1239
4: 1047
Right 1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG No data
1051205324_1051205325 15 Left 1051205324 9:14682576-14682598 CCACACAATAATAATGGGAGACT 0: 3585
1: 5527
2: 2752
3: 1484
4: 1003
Right 1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051205325 Original CRISPR CAACATTAGATCAACGAGAC AGG Intronic
No off target data available for this crispr