ID: 1051209088

View in Genome Browser
Species Human (GRCh38)
Location 9:14722562-14722584
Sequence TTTCCCCCGTACTCCTGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051209088_1051209095 29 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1051209088_1051209091 6 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209091 9:14722591-14722613 TCTGATTCTGGCGGCCATCCTGG 0: 1
1: 0
2: 0
3: 5
4: 142
1051209088_1051209089 -6 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209089 9:14722579-14722601 GGGAAAGAGAACTCTGATTCTGG 0: 1
1: 0
2: 0
3: 20
4: 250
1051209088_1051209090 -3 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209090 9:14722582-14722604 AAAGAGAACTCTGATTCTGGCGG 0: 1
1: 0
2: 1
3: 26
4: 287
1051209088_1051209092 16 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209092 9:14722601-14722623 GCGGCCATCCTGGTGCCGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051209088 Original CRISPR TTTCCCCCGTACTCCTGCCA AGG (reversed) Exonic
901099963 1:6712381-6712403 TTTCCTCCTTTCTCCTGCCTGGG + Intergenic
901959029 1:12810114-12810136 CTTCCCCTGGACTCATGCCAAGG + Intergenic
904383759 1:30128457-30128479 TTTCCCCCATACTCTTCTCATGG + Intergenic
905246184 1:36615555-36615577 TTTCCCCTGCCCTCCTGCCCTGG - Intergenic
907353244 1:53850794-53850816 TTTCCCCCATACTCTTCTCATGG + Intergenic
907844963 1:58196755-58196777 TTTCCCCCGTGCTGCTCTCATGG - Intronic
909257186 1:73439032-73439054 TTTCCCACCTGCTCCAGCCATGG + Intergenic
909318511 1:74253425-74253447 TTCCCCCCGACCCCCTGCCATGG - Intronic
909627629 1:77735707-77735729 TTTCCCCGGAACTTCTGCTAAGG + Intronic
909694695 1:78453729-78453751 TTTCCCCCGTACTGTTCTCATGG + Intronic
910140509 1:84022074-84022096 TTTCCCCCGTACTGTTCTCATGG - Intergenic
912680141 1:111723793-111723815 TTCCCCCTGGACACCTGCCATGG - Exonic
912773967 1:112491846-112491868 GTGCCACCGTACTCCTGCCTGGG + Intronic
915877591 1:159628311-159628333 TTTCCCCCATACTGTTTCCATGG + Intergenic
917116374 1:171608056-171608078 TTTCCCCCATACTGCTGTCGTGG - Intergenic
920758460 1:208758376-208758398 TTTCCCCTTTCCTGCTGCCAAGG + Intergenic
921609494 1:217194429-217194451 TTACCCCTGTAATGCTGCCAAGG - Intergenic
924783491 1:247172923-247172945 TTTCCCACCTGCTCTTGCCAGGG + Intergenic
1063445511 10:6112189-6112211 TTTCCCTTCTTCTCCTGCCAGGG + Exonic
1064991947 10:21264005-21264027 CCTCCCTCCTACTCCTGCCATGG - Intergenic
1066082720 10:31948086-31948108 TTGCCACCGTACTCCAGCCTGGG - Intergenic
1069047799 10:63761525-63761547 TTTCCCCGATTCTCCTGCCATGG - Intergenic
1069352507 10:67546174-67546196 TTACCCCTGTACTCCAGCCTAGG - Intronic
1071291631 10:84193479-84193501 TTCCCCCCCTCCCCCTGCCAGGG - Intergenic
1072377462 10:94832417-94832439 TTTCCCCCATACTGTTGTCATGG - Intronic
1073785583 10:106885788-106885810 TTTCCCCCATACTGCTCTCATGG + Intronic
1074702245 10:116102704-116102726 TTTCCCCCGTACTCTTCTCATGG - Intronic
1074784754 10:116829153-116829175 TTTCCCCCATACTGTTCCCATGG + Intergenic
1075822669 10:125328150-125328172 TTTCCCCCATACTGTTGTCATGG + Intergenic
1077314756 11:1913865-1913887 TTTCCCTCGTCATGCTGCCACGG + Intergenic
1079625488 11:22612024-22612046 TTTCCCCCATACTCTTCTCATGG - Intergenic
1081066746 11:38551352-38551374 TTGCCACTGTACTCCTGCCTGGG - Intergenic
1082049115 11:47755746-47755768 TCTCCACTGTACTCCAGCCAGGG + Intronic
1082560863 11:54619037-54619059 TTTCATCCGTACCCCTGCAAAGG + Intergenic
1083704092 11:64501223-64501245 TTGCCCCGGTACTCCAGCCTGGG - Intergenic
1085449725 11:76624632-76624654 TTTCCCTCGTTCTCCGGGCAGGG + Intergenic
1088470291 11:110182556-110182578 TTGCCACGGTACTCCAGCCAGGG + Intronic
1089703115 11:120257572-120257594 TTTCCCCTGCACTCCAGCCCTGG + Intronic
1091460183 12:638281-638303 TTTCCTCTCTACTCCAGCCAGGG + Intronic
1091538230 12:1434009-1434031 TTTCCCTGGTTCTCCTACCAGGG - Intronic
1092205943 12:6614190-6614212 TTTCTCCCGCCCTCCTGCCCTGG + Intergenic
1094619744 12:32068411-32068433 GTGCCACCGTACTCCTGCCTGGG + Intergenic
1095970370 12:47897631-47897653 TTTCCCCAGTAGTCCTAGCAGGG + Intronic
1097026599 12:56060713-56060735 TTGCACCTGTACTCCAGCCAGGG - Intergenic
1097057399 12:56258204-56258226 TTTCCCGCTTCCTCCTTCCAGGG - Intronic
1097318993 12:58204816-58204838 TTTTCACCTTACTCCTGCCTTGG - Intergenic
1097955190 12:65477983-65478005 TTTCCCCAACACTCCAGCCAAGG + Intronic
1098054170 12:66486501-66486523 TTTCCCCCGTACTATTCTCATGG + Intronic
1098657380 12:73050230-73050252 TTTCACCTGTACTCTGGCCAGGG + Intergenic
1098669147 12:73202678-73202700 TTTCCCCCATACTCTTTTCATGG - Intergenic
1098796022 12:74888962-74888984 TTTCCCCCATACTGCTCTCACGG - Intergenic
1098840854 12:75476241-75476263 TTTCCCCCATACTTTTGTCATGG - Intergenic
1103328776 12:120139265-120139287 GTGCCCCTGTACTCCTGCCTGGG + Intronic
1103438529 12:120945701-120945723 TTTCCCCCATACTGCTCTCAGGG + Intergenic
1105025935 12:132848987-132849009 GTTCCCCTGTACTCCAGCCTGGG - Intronic
1106612716 13:31299051-31299073 ATTCCAACGTACTCCTGCCTTGG + Intronic
1108724337 13:53163752-53163774 TGTCCCCCTGACTCCAGCCATGG - Intergenic
1109810572 13:67508375-67508397 TTTCCCCCATACTGTTCCCATGG + Intergenic
1110981106 13:81899490-81899512 TTTCCCCCATACTGTTTCCATGG - Intergenic
1111155064 13:84310626-84310648 TTTCCCCCGTACTGTTCTCATGG + Intergenic
1114979343 14:28143472-28143494 TTTCTCCTGTACTACAGCCAAGG + Intergenic
1115134628 14:30094271-30094293 TTTCCCCCATACTGTTGTCATGG - Intronic
1115896849 14:38098758-38098780 ATTCCACCGTACTCCAGCCTGGG + Intergenic
1119295287 14:73527916-73527938 TTGCCACCGTACTCCAGCCTGGG + Intronic
1119956088 14:78799849-78799871 TTTCCCCCATACTGCTCTCATGG - Intronic
1122159705 14:99774140-99774162 TCTCCCCTGGAGTCCTGCCAAGG - Intronic
1122808304 14:104273035-104273057 TTTCCCCCATACTCTTCTCAAGG + Intergenic
1127652563 15:61023442-61023464 TTTCCCCCATACCATTGCCATGG - Intronic
1129239083 15:74241111-74241133 TCTCCCCCATGCTCCTGTCAGGG - Intronic
1129848341 15:78778189-78778211 TTTCCCCGCTACCGCTGCCAGGG - Intronic
1132200976 15:99954511-99954533 TTTCCCCCTTGCTTCAGCCAGGG - Intergenic
1133473400 16:6097058-6097080 TTTCCCCCATACTGTTGTCATGG + Intronic
1134264456 16:12681340-12681362 TTTCCTCCTCACTCTTGCCAGGG + Intronic
1136005314 16:27325155-27325177 TCTCCCCCTTGCTCCAGCCAAGG + Intronic
1137566012 16:49532919-49532941 TCTCCCCCTTTCTCCTGCCATGG - Intronic
1137619497 16:49867108-49867130 TCTTCCCCTTACTCCTGCTATGG - Intergenic
1139297568 16:65916607-65916629 TTTCCCCCGTACTGTTCTCATGG - Intergenic
1140188615 16:72795960-72795982 CTTCCCCAGTACTCCTGCTTTGG + Exonic
1141241724 16:82271154-82271176 TTTCCCCCGTACTGCTCTCATGG - Intergenic
1143416241 17:6753049-6753071 TTTCCCCCCGATTCCTGCAAAGG + Intergenic
1144626143 17:16845316-16845338 CTTCCCCCCAACTCCTGCCCTGG - Intergenic
1144880291 17:18427404-18427426 TTTCCCCCCAACTCCTGCCCTGG + Intergenic
1145151942 17:20516983-20517005 TTTCCCCCCAACTCCTGCCCTGG - Intergenic
1145259904 17:21348537-21348559 TTTCCCCCATTCTCCAGACAAGG - Intergenic
1145316712 17:21739401-21739423 TTTCCCCCATTCTCCAGACAAGG + Intergenic
1146163313 17:30571254-30571276 CTTCCCCCCAACTCCTGCCCTGG - Intergenic
1147316245 17:39621750-39621772 TCTGCCCCGTCCTCCTGCCCAGG - Intergenic
1147557977 17:41491666-41491688 TCTCCCCAGTTCTCCTGGCAGGG + Intronic
1147580285 17:41624013-41624035 CTTCCCCCCAACTCCTGCCTTGG - Intronic
1148478077 17:47941988-47942010 TTTCCCCGGAACTCCTCCCCTGG - Intronic
1149573911 17:57697780-57697802 TTTCCCCCGTACTGTTCTCATGG - Intergenic
1150457509 17:65319060-65319082 ATTCTCCTGTACACCTGCCATGG - Intergenic
1150675856 17:67245413-67245435 TTTCTCCCTTTCTCCTGCCCCGG + Intronic
1150978140 17:70111721-70111743 TTTCCCCCATACTGTTCCCATGG + Intronic
1152702460 17:81825812-81825834 TCTGCCCAGTCCTCCTGCCAGGG + Exonic
1158316741 18:56219266-56219288 ATGCCCCCGCACTCCAGCCAGGG + Intergenic
1158732378 18:60038217-60038239 TTTCCCCCATACTGCTCTCATGG - Intergenic
1159144899 18:64441853-64441875 ATGCCCCTGTACTCCAGCCAGGG + Intergenic
1160157744 18:76446338-76446360 TTTCCCCAGCACTCCTGGAAGGG - Intronic
1161180987 19:2882063-2882085 TTGCCACTGTACTCCAGCCAGGG + Exonic
1163274911 19:16277418-16277440 TGCCCCCCATATTCCTGCCAAGG - Intergenic
1166674423 19:44731234-44731256 TTGCCACCGAACTCCTGCCTGGG - Intergenic
926394561 2:12427858-12427880 CTTCCCCACTACCCCTGCCAGGG + Intergenic
926759122 2:16261907-16261929 TTTCCCCTGTCCTCCTGCCCTGG + Intergenic
927190749 2:20515345-20515367 TTTCCCCCGTACTGTTCTCATGG - Intergenic
930524367 2:52508424-52508446 TTGCCACCGTACTCCAGCCTGGG + Intergenic
933446454 2:82386170-82386192 TCTTCCCCTTACTTCTGCCAAGG - Intergenic
936612036 2:114010907-114010929 ATGCCCCCGCACTCCAGCCAAGG + Intergenic
937286215 2:120753797-120753819 TTTCCGCCATTCTCCTGCCTCGG - Intronic
938964677 2:136377763-136377785 TTTCCCTCCTACTGCTCCCATGG + Intergenic
940344919 2:152619167-152619189 CTTCCTCAGTCCTCCTGCCAAGG - Intronic
940727731 2:157354002-157354024 TTTCCACCGTACTCTTCTCATGG - Intergenic
941057510 2:160806015-160806037 TTTCCCCCATACTGTTGTCATGG - Intergenic
945227686 2:207549030-207549052 TTTTCCCTGTGCTCCTACCAAGG - Intronic
946397638 2:219451347-219451369 GTTCCCCCGGACTCCTCCAAGGG + Intronic
946757913 2:222965364-222965386 TTTCCCCCATACTGCTCTCATGG - Intergenic
948017511 2:234702241-234702263 TTTCCCCCATACTGCTTTCATGG + Intergenic
1170274004 20:14563078-14563100 ATTCCACCCTACTCCTGCAATGG - Intronic
1171469298 20:25357091-25357113 ATGCCCCCTTAATCCTGCCAAGG + Intronic
1172140850 20:32722200-32722222 TTGCCCCTGTACTCCAGCCTGGG + Intronic
1174168943 20:48604467-48604489 TTTCAGCCCTGCTCCTGCCATGG + Intergenic
1174609313 20:51786127-51786149 ATTCCACCGTACTCCAGCCTGGG - Intronic
1175958704 20:62624239-62624261 CTTCCCAGGTGCTCCTGCCAAGG - Intergenic
1176959223 21:15140495-15140517 TCTCCCCCTTATGCCTGCCATGG - Intergenic
1178296864 21:31417508-31417530 TTTCCCCCGTACTGTTCTCATGG - Intronic
1178868094 21:36346961-36346983 TTGCCCCTGTACTCCAGCCTGGG + Intronic
1183306904 22:37087532-37087554 TTTCCCCTGGCCTCTTGCCAGGG + Intronic
1184438520 22:44495081-44495103 GTTCCCCTGGACTCCAGCCAAGG - Exonic
952170137 3:30798461-30798483 TTTCCCCCATACTGCTGTCATGG - Intronic
952507584 3:34021458-34021480 TTTCCCCCTTGCTGTTGCCACGG + Intergenic
954948985 3:54452315-54452337 TTTCCCCCATACTGTTCCCATGG - Intronic
955671302 3:61406008-61406030 TTTCCCCCATACTGCTCTCATGG + Intergenic
957098869 3:75804373-75804395 TTGCCACCGTACTCCAGCCTGGG + Intergenic
961240935 3:125411010-125411032 TTTCCCTCGAACTCCTGGCTGGG + Intergenic
964070378 3:152624823-152624845 ATTCCCCTGTACTCCAGCCCGGG - Intergenic
966140274 3:176749230-176749252 TTTCCCCCGTACTGTTCTCATGG - Intergenic
967146677 3:186612468-186612490 TTCCCACCGTGGTCCTGCCACGG + Intergenic
967857046 3:194125981-194126003 TGTCCCCCGACCTCCTGCCCTGG + Intergenic
968516260 4:1016906-1016928 TTTCCCACTCACTCCTGCCCTGG + Intronic
970333684 4:15009389-15009411 TTTCCAAAGTAGTCCTGCCAGGG + Intronic
971570327 4:28204044-28204066 TTTCCCCCATACTCATTTCATGG - Intergenic
971629643 4:28974157-28974179 TTTCCCCCATACTGTTCCCATGG - Intergenic
972428972 4:38962107-38962129 TTTCCCCCATACTATTGTCATGG + Intergenic
972831095 4:42814519-42814541 TTTCCCCCATACTTTTCCCATGG - Intergenic
973094110 4:46175813-46175835 TTTCCCCCATACTCTTCTCATGG - Intergenic
973830509 4:54754635-54754657 TTTTCCCCGTAATCTTGCCTTGG + Intergenic
976443083 4:85098994-85099016 TTTCCCCCATACTCTTCTCATGG - Intergenic
977675730 4:99744776-99744798 TTTCCCCCATACTGTTCCCATGG - Intergenic
980020531 4:127704454-127704476 TGTACCCCGTACTCCAGCCTAGG - Intronic
980276723 4:130661943-130661965 TTTCCCCCATACTCTTCTCATGG + Intergenic
981238199 4:142442998-142443020 TTTCCCCCATACTGTTCCCATGG - Intronic
985779371 5:1862087-1862109 TTTCCCCGGAACTCCTGTCCTGG + Intergenic
985808357 5:2065104-2065126 TTTCCCCCATACTGCTCTCATGG + Intergenic
986416278 5:7531140-7531162 TTTCCCTCTTACTTATGCCAAGG - Intronic
986842853 5:11717791-11717813 TTTCCCCCATACTGTTCCCATGG - Intronic
988025931 5:25689831-25689853 TTTCCCCCGTACTCTTCTCATGG - Intergenic
988494490 5:31733398-31733420 TTTCCCCCGTTCTCTTGCTTTGG + Intronic
989061016 5:37411681-37411703 ATGCCACCGTACTCCTGCCTGGG + Intronic
989167498 5:38445955-38445977 TTTCCCCTGAACTCCTTGCAAGG - Intronic
989585653 5:43072364-43072386 TTTCACTCGTACTGCTGCCCAGG + Intronic
990844696 5:60123510-60123532 TTTCCCCCATACTGCTCTCATGG - Intronic
991165044 5:63556241-63556263 GTGCCCCCGTACTCCAGCCTGGG + Intergenic
992662125 5:78972132-78972154 TTTCCCTCTCACTCCTGCCAGGG - Intronic
996582605 5:125048224-125048246 TTTGCCCCTCACTCCAGCCATGG + Intergenic
998010544 5:138692014-138692036 TTTCCCCCGTGCTGCTCTCATGG - Intronic
998735785 5:145139074-145139096 TTGCCACCGTACTCCAGCCCGGG - Intergenic
999100321 5:149018576-149018598 TTTCCCCCATACTCTTCTCATGG - Intronic
999151950 5:149432218-149432240 CTTTCCCCGTACTCTTGCTAGGG + Intergenic
1002405098 5:179024124-179024146 TTTCCCCCGGAGTCCGGCCCAGG - Intronic
1002496724 5:179619342-179619364 CCTCCCCCGTACTCCTCCCCTGG + Exonic
1003172627 6:3732299-3732321 TTTCCCATGTACTCCAGCAACGG + Intronic
1003200824 6:3958695-3958717 TTTCCCCCATACTGCTCTCATGG + Intergenic
1003211679 6:4073887-4073909 GTGCCCCCGTACTCCAGCCTGGG - Intronic
1007423431 6:41733356-41733378 TATCCCCTGAACTCCTTCCAGGG + Intronic
1007445355 6:41901473-41901495 TTGCCACCGTACTCCAGCCTGGG - Intergenic
1011123586 6:83982283-83982305 TTTCCCCCATACTATTGTCATGG - Intergenic
1011947772 6:92928226-92928248 TTTCCCCCATACTCTTTTCATGG + Intergenic
1011963019 6:93115196-93115218 TTTCCCCCGTACTGTTCTCATGG + Intergenic
1013503176 6:110772350-110772372 TTTCCCCCCTACTGCTCTCATGG - Intronic
1013948702 6:115753237-115753259 TTTCCCCCATACTCTTCTCATGG + Intergenic
1014471349 6:121818958-121818980 TTTCCCCCATACTCTTCTCATGG + Intergenic
1015338460 6:132069391-132069413 TTTCCACCCGCCTCCTGCCAGGG + Intergenic
1016750141 6:147622964-147622986 TTTCCCCCATACTGTTCCCATGG - Intronic
1016762947 6:147759682-147759704 TTTTCCCACTACTCCTGCCTTGG - Intergenic
1018203628 6:161416811-161416833 TGTCACCCGTCCTCCTGCCCAGG + Intronic
1021232519 7:18103181-18103203 TTTCCCCCATACTGTTCCCATGG - Intronic
1023376933 7:39566105-39566127 TTTCCACCGTAGTCTTACCATGG - Intergenic
1024156621 7:46632237-46632259 TTTCCCCCGTACTGTTCTCATGG + Intergenic
1024329417 7:48141300-48141322 TTTCTCCCCTACCCCTGACATGG + Intergenic
1026107702 7:67434021-67434043 TTTCCCCCATACTGTTGTCATGG + Intergenic
1026278546 7:68901819-68901841 TTTCCCCCATACTGTTCCCATGG + Intergenic
1028668495 7:93373534-93373556 TTTCCCCCATACTCTTCTCATGG - Intergenic
1029745044 7:102512063-102512085 CTTCCCCCGCACTCCTCCCGAGG - Intronic
1029763036 7:102611224-102611246 CTTCCCCCGCACTCCTCCCGAGG - Intronic
1032689369 7:134267536-134267558 TTTCCCCCATACTGTTCCCATGG + Intergenic
1034881510 7:154766358-154766380 TTGCCACCGTACTCCAGCCTGGG - Intronic
1035674248 8:1443730-1443752 TTTCCCCCATACTCTTCTCATGG - Intergenic
1036565330 8:9933684-9933706 TTTCCCCCTTATTCCTTCCACGG + Intergenic
1038963427 8:32547824-32547846 TTCCCCCCGCACCCCTCCCAGGG + Intronic
1040623548 8:49117628-49117650 TTTCCCCCATACTGTTCCCATGG - Intergenic
1040926743 8:52692609-52692631 TTTCCCCCGTGATCCAGCTATGG - Intronic
1041961940 8:63627906-63627928 TTTCCCCGGCACTTTTGCCATGG + Intergenic
1042080737 8:65048040-65048062 TTTCCCCCATACTGCTCTCATGG - Intergenic
1042480064 8:69292667-69292689 TTTCCCAACTACTCCTGCCTTGG + Intergenic
1043265998 8:78267859-78267881 TTTCCCCCATACTGCTCTCATGG + Intergenic
1048416392 8:134232007-134232029 TTTCCCCCATACTGCTCTCATGG - Intergenic
1048973941 8:139660911-139660933 TTTCCCCTGTCCTCTGGCCATGG + Intronic
1050188381 9:2998867-2998889 TTTCCCAGTTAGTCCTGCCAGGG - Intergenic
1051209088 9:14722562-14722584 TTTCCCCCGTACTCCTGCCAAGG - Exonic
1053079498 9:35162478-35162500 TTTCCCCCAAGCTCCTGCAAGGG + Intronic
1055658027 9:78471791-78471813 TTGCCCCCTTTATCCTGCCAGGG - Intergenic
1057616150 9:96592119-96592141 TTTCCACTGTACTCCAGCCTGGG - Intronic
1061011232 9:127955817-127955839 CTTACCCTGTGCTCCTGCCAAGG + Intronic
1061656781 9:132098004-132098026 TCTCCTCACTACTCCTGCCAAGG - Intergenic
1185574592 X:1161001-1161023 TTTCCCCCGTACTGTTCTCAGGG - Intergenic
1187498168 X:19814255-19814277 TCTCCCCTGTATTCCTGCAAAGG + Intronic
1188795920 X:34464721-34464743 TTTCCTCCTTACTACTACCAAGG - Intergenic
1189473665 X:41333349-41333371 TTTCCCCCCGACTCCCGCCCCGG + Intronic
1190049144 X:47136438-47136460 TTGCCACTGTACTCCAGCCAGGG + Intergenic
1191878781 X:65823625-65823647 TTTCCCCCATACTGTTCCCATGG - Intergenic
1192303314 X:69929815-69929837 TGTCCCTCCCACTCCTGCCATGG + Intronic
1194322399 X:92465102-92465124 TTTCCACTGCACTCCTGCCTGGG + Intronic
1195154659 X:102110723-102110745 TTTCCCCCATACTGCTCTCATGG + Intergenic
1197540408 X:127752894-127752916 TTTCCCCCATACTGTTCCCATGG + Intergenic
1198017328 X:132624716-132624738 TTACCCCCGTACTCCACCCATGG + Intergenic
1198044677 X:132889408-132889430 CTTCCCCCCTTCTCTTGCCATGG - Intronic
1198433041 X:136587234-136587256 TTTCCCATGTTCTCCTACCATGG - Intergenic
1198697593 X:139359127-139359149 TTTCCCCCATACTGTTCCCATGG - Intergenic
1200244003 X:154513108-154513130 TTTCCTCCTTCCACCTGCCAGGG - Intronic
1200630557 Y:5578580-5578602 TTTCCACTGCACTCCTGCCTGGG + Intronic
1202038678 Y:20660701-20660723 TTCCTCCCCTACTCCTGACATGG + Intergenic