ID: 1051209095 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:14722614-14722636 |
Sequence | TGCCGTGTGGTCTTTCCTAG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 70 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 65} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1051209088_1051209095 | 29 | Left | 1051209088 | 9:14722562-14722584 | CCTTGGCAGGAGTACGGGGGAAA | 0: 1 1: 0 2: 0 3: 12 4: 218 |
||
Right | 1051209095 | 9:14722614-14722636 | TGCCGTGTGGTCTTTCCTAGAGG | 0: 1 1: 0 2: 0 3: 4 4: 65 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1051209095 | Original CRISPR | TGCCGTGTGGTCTTTCCTAG AGG | Exonic | ||