ID: 1051209095

View in Genome Browser
Species Human (GRCh38)
Location 9:14722614-14722636
Sequence TGCCGTGTGGTCTTTCCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051209088_1051209095 29 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051209095 Original CRISPR TGCCGTGTGGTCTTTCCTAG AGG Exonic