ID: 1051209095

View in Genome Browser
Species Human (GRCh38)
Location 9:14722614-14722636
Sequence TGCCGTGTGGTCTTTCCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051209088_1051209095 29 Left 1051209088 9:14722562-14722584 CCTTGGCAGGAGTACGGGGGAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051209095 Original CRISPR TGCCGTGTGGTCTTTCCTAG AGG Exonic
900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG + Intergenic
921140927 1:212305438-212305460 TGTGGTCTGGTCTTTCCTGGTGG + Intronic
921484873 1:215703765-215703787 AGCCGTGTGGTCTTGCTCAGTGG - Intronic
922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG + Intronic
922855399 1:228770870-228770892 TGCAGTTTGGTGTTTCCAAGTGG + Intergenic
1081926671 11:46835313-46835335 TGCCGTCTGCTCCTTGCTAGTGG - Intronic
1083189083 11:61036536-61036558 TGCAGTGTGGTCTTTGCCAGGGG - Intergenic
1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG + Intronic
1095254433 12:40017933-40017955 TTCAGTGTGGTAATTCCTAGTGG - Intronic
1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG + Intronic
1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG + Intergenic
1106450084 13:29873133-29873155 AGCCATGTGGTTTTTCCTGGAGG + Intergenic
1108286107 13:48909507-48909529 TTCCGTGTGTTCTGTCTTAGAGG - Intergenic
1108735698 13:53281509-53281531 TGCCATGTGGTCATATCTAGAGG + Intergenic
1113563617 13:111303784-111303806 TGCCGTATGGGCCTTCCTTGAGG - Intronic
1121516921 14:94558565-94558587 GGCCCAGTGGTATTTCCTAGGGG + Intergenic
1121801396 14:96777221-96777243 AGCAGCATGGTCTTTCCTAGGGG + Intergenic
1121905393 14:97737125-97737147 TGCCATGCTGTCTTTCATAGTGG + Intergenic
1122667110 14:103338205-103338227 TGCTGTGTGGTTTTTCTGAGGGG + Intronic
1127435841 15:58957414-58957436 TGGCGTCTGGTCTTCCCTAGAGG + Intronic
1131486503 15:92825278-92825300 TGCTGTGTGATCTTTACTATGGG - Intergenic
1147795298 17:43037869-43037891 TGGCGGGAGGTCTTTCCTGGAGG - Intergenic
1150431925 17:65125286-65125308 TGCGGGGTGGTCTTTCCTGAAGG - Intergenic
1154164285 18:12002836-12002858 TGCAGTGGGGTTTTTCATAGCGG - Intronic
1155436676 18:25819863-25819885 TGCTGCTTGCTCTTTCCTAGTGG - Intergenic
1161729115 19:5948117-5948139 TGCTTTCTGGCCTTTCCTAGGGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164537277 19:29095248-29095270 TGCCCTGCAGTCTTTTCTAGAGG - Intergenic
1164557541 19:29265410-29265432 TGTAATGTGGTCTTTCCCAGAGG - Intergenic
1167125594 19:47546107-47546129 TGCTGGGTGGTCTTTCCTCGTGG - Intronic
1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG + Intergenic
927397423 2:22669928-22669950 TGCAGTCTGGCCTTTCCTGGTGG + Intergenic
929392735 2:41489982-41490004 TGCCATGTGGACCTTTCTAGAGG + Intergenic
934831138 2:97526208-97526230 TGCTGTGTGATCTTTCCTCTGGG - Intronic
947874501 2:233459394-233459416 TGCCATCTGCTCTTTTCTAGGGG + Intronic
1170481337 20:16768050-16768072 TGGCATGAGGTCTTTCCTTGTGG + Intronic
1179389629 21:40975861-40975883 TGCCATGTGGTCTTCTCTATAGG + Intergenic
1180663137 22:17486531-17486553 AGCCATGTGGGCTTTCCCAGTGG - Intronic
1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG + Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG + Intronic
956228813 3:66989598-66989620 TGCCGTGTTGTTTTTCCAATGGG + Intergenic
960293890 3:115919079-115919101 TGCTGTGTGGTCTGCCCTACAGG - Intronic
966201497 3:177363065-177363087 TGCAGAGTGGTCTTTCCCTGTGG - Intergenic
978843040 4:113237099-113237121 TTTGGTGTCGTCTTTCCTAGCGG - Exonic
981827653 4:148962006-148962028 TTCCGTGTGGTCTCTCCAACAGG - Intergenic
988067301 5:26237587-26237609 CGACGTGTGGCCTTTCCTGGTGG + Intergenic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994015029 5:94955454-94955476 TGCCGAGTGGTCTTGCTCAGTGG + Intronic
995034661 5:107519657-107519679 TGCAGTGTGTGCTTTCCAAGGGG - Intronic
996811072 5:127517206-127517228 TGCCGCGAGGTCCTTCCTGGAGG + Intergenic
1012720463 6:102736277-102736299 TGCCTTCTGGTCTACCCTAGTGG - Intergenic
1013314426 6:108927431-108927453 TGCAGTGTGCTCCTTCCTTGTGG - Intronic
1013842374 6:114412889-114412911 TGCAGTGTGCTCATTGCTAGTGG - Intergenic
1019147317 6:169983702-169983724 TGCCTTGTGGTTTTTCCTTGTGG - Intergenic
1019971847 7:4547843-4547865 TGCCGTGTGTTCACTGCTAGGGG - Intergenic
1020333393 7:7042324-7042346 AGCCGAGTGGTCTTGCCCAGTGG + Intergenic
1026664745 7:72332590-72332612 TGACTTGTGGTCTCTCCCAGGGG - Intronic
1034648728 7:152672360-152672382 TACAGGGTGGTCTTTGCTAGAGG - Intronic
1036085043 8:5604353-5604375 TGACGTGTGCTCCTTCCTGGAGG - Intergenic
1038219134 8:25591121-25591143 TACAGTGTGGTGTGTCCTAGAGG - Intergenic
1041228972 8:55730232-55730254 TGCCTTATGCTCTTTGCTAGTGG - Intronic
1041703929 8:60824878-60824900 TGCTGTGTGTGATTTCCTAGTGG + Intronic
1046341855 8:112869466-112869488 TGCAGTGTGGTGTTTCCTCAAGG + Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1062381717 9:136290085-136290107 GGGCGTGTGGTCTTCCCGAGCGG - Intronic
1190784290 X:53629118-53629140 TGCCTTTTGGTTTTTCCCAGAGG - Intronic
1192738758 X:73873738-73873760 TACCATATGGTCTATCCTAGAGG - Intergenic
1196662617 X:118283330-118283352 TGCAGCCTGGCCTTTCCTAGAGG + Intergenic
1200187753 X:154193909-154193931 TGCCGTGTGCTCTTCCCTTCCGG + Intergenic