ID: 1051210546

View in Genome Browser
Species Human (GRCh38)
Location 9:14737763-14737785
Sequence TGGTAGAGCTAGAATTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051210546_1051210550 4 Left 1051210546 9:14737763-14737785 CCAGTCCAATTCTAGCTCTACCA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1051210550 9:14737790-14737812 CTTGCTAGATGAGCATCTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 138
1051210546_1051210551 8 Left 1051210546 9:14737763-14737785 CCAGTCCAATTCTAGCTCTACCA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1051210551 9:14737794-14737816 CTAGATGAGCATCTTTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 111
1051210546_1051210549 3 Left 1051210546 9:14737763-14737785 CCAGTCCAATTCTAGCTCTACCA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1051210549 9:14737789-14737811 ACTTGCTAGATGAGCATCTTTGG 0: 1
1: 0
2: 2
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051210546 Original CRISPR TGGTAGAGCTAGAATTGGAC TGG (reversed) Intronic
902239375 1:15078221-15078243 TAGTAGAGATGGAATTGGCCAGG - Intronic
903402741 1:23068561-23068583 TGGTAGAGCAAGAGTTTAACCGG + Exonic
906368876 1:45235471-45235493 TGATAGAGATAGAGTTGGCCAGG + Intronic
913094701 1:115505088-115505110 TGTCAGAGTTAGAATTGGAATGG - Intergenic
1064447458 10:15408250-15408272 TGGTAGAGATAGAATCTCACTGG + Intergenic
1064563948 10:16621110-16621132 TGGCAGAGGCAGAATTGCACAGG - Intronic
1065953377 10:30672500-30672522 TTGTAGAGCTAGAAGGGGCCTGG - Intergenic
1069821815 10:71233178-71233200 AGGTAAAGCAAGAGTTGGACTGG + Intronic
1072420334 10:95285692-95285714 TGGTAGAGCTGGAGTTTGGCTGG - Intronic
1074624935 10:115172485-115172507 TGGTAGATCAAGAAATTGACAGG - Intronic
1074985294 10:118652972-118652994 TTGTAGATCTAGTATGGGACAGG - Intergenic
1084738356 11:71120820-71120842 TGTTGGAGCTTGAATTGGAGGGG - Intronic
1085193427 11:74649366-74649388 TGGTAGAGCTGGGATTTGAGAGG + Intronic
1085337793 11:75709727-75709749 TGTTAAAGCTAGAATTTGAATGG - Intergenic
1086984670 11:93234762-93234784 GGGTAGTGCCAGGATTGGACAGG - Intergenic
1095561984 12:43576071-43576093 TGGAAGAACTAGAACTGTACTGG + Intergenic
1100733335 12:97498319-97498341 TGGTTGAACCAGAATTGGACTGG + Intergenic
1100819325 12:98416649-98416671 AAGTAGAGCTAGAGTTGGCCAGG + Intergenic
1102602586 12:114043379-114043401 TGGTAGAGTGAGATTTGAACTGG + Intergenic
1106944040 13:34805540-34805562 TGGTTGTGCTAGAATGGGATGGG - Intergenic
1108313813 13:49219762-49219784 TTGTAGAGCCAGGATTAGACAGG + Intergenic
1112971033 13:105263020-105263042 TTGTAAAACTAGAATTGGAGCGG + Intergenic
1115365123 14:32549296-32549318 CAGTGGAGCTAGAATTTGACTGG + Intronic
1115388820 14:32830073-32830095 TGGTAGAGGTAGCTTGGGACAGG - Exonic
1116812420 14:49552299-49552321 TGAAAGACCTAGAAATGGACAGG + Intergenic
1117051561 14:51865505-51865527 TGGTAGAGCTAAAAATGATCTGG + Intronic
1120560573 14:85987410-85987432 TGTTAGAGATAGAAGTGGTCAGG + Intergenic
1125013695 15:34908635-34908657 TGGTAGAATGAGAACTGGACAGG - Intronic
1126370011 15:47935635-47935657 TGACAGAGTTAGAATTGAACTGG + Intergenic
1128428117 15:67564111-67564133 TGGTAGAAAGAGCATTGGACTGG + Intronic
1131151346 15:90049304-90049326 TGGAAGCTCTAGAATTGGCCTGG - Intronic
1133732664 16:8590073-8590095 AGGTAGAGCTGGCATTGGAGGGG - Intergenic
1135487794 16:22881080-22881102 TGGCAGAGCTAGAATTTGAATGG - Intronic
1140307374 16:73816041-73816063 TGGTAGAGACTGTATTGGACAGG + Intergenic
1140798298 16:78461226-78461248 AGGAGAAGCTAGAATTGGACAGG - Intronic
1141380894 16:83575660-83575682 TGGTTGAGCTAAAATCTGACGGG - Intronic
1144549888 17:16230969-16230991 TGTTAGAACAAGAAATGGACTGG - Intronic
1146121206 17:30196919-30196941 AGGAAAACCTAGAATTGGACAGG + Exonic
1146604060 17:34243004-34243026 TGGTAGTGCGAGAATATGACAGG - Intergenic
1153212237 18:2779890-2779912 TGGCAGAGCTAGAACTAAACTGG + Intronic
1156319336 18:36004125-36004147 TGTTAGAGCTAGAATTTGTCTGG - Intronic
1160818118 19:1045522-1045544 GGGTGGAGCTAAAATTGCACCGG + Intronic
1162179647 19:8859324-8859346 TGGTAGAAAGAGAATTGAACAGG - Intronic
1163212667 19:15852599-15852621 TGGCAGAGCTGGAATTTGAATGG - Intergenic
1166049018 19:40247093-40247115 TGGTCCAGTTAGAATTGGATCGG - Intronic
1166705213 19:44904623-44904645 TGTTAGGGCTAGCAATGGACAGG - Intergenic
926435246 2:12830598-12830620 TGGTAGAGACAAAGTTGGACTGG + Intergenic
928538147 2:32259713-32259735 TGGCAGAGATGGAATTTGACTGG - Intronic
931206142 2:60147695-60147717 TGGGAGAGCAAGACCTGGACTGG + Intergenic
933415341 2:81980559-81980581 TGGAAGAGACAGAACTGGACTGG - Intergenic
941326832 2:164126153-164126175 TGGAAGTGCTAAAATTGGCCTGG + Intergenic
941811380 2:169759083-169759105 TTGTAGAGATAGAGTTGCACAGG - Intronic
943673700 2:190694962-190694984 TGGGAGACCTAGAATTTAACAGG - Intergenic
947790068 2:232860917-232860939 TGGTAGTGCTGGTTTTGGACTGG + Intronic
948290768 2:236822685-236822707 AGGGAGAGGTAGAATTGGAGAGG + Intergenic
1168829509 20:837628-837650 TGGTGGAGCTAGGATTTGAATGG + Intronic
1170089849 20:12578763-12578785 TGGTGGAGCTAGAAGAGTACTGG - Intergenic
1170793469 20:19526559-19526581 TGGTAGAGCTAAATTTTGATCGG - Intronic
1175432645 20:58917463-58917485 TGAGAGACCTAGAATTGGAAGGG + Intergenic
1179132631 21:38652226-38652248 TGGTAGAGATAGCAGTGGGCGGG - Intronic
1181664298 22:24381282-24381304 TGCTAGACCTAGAAATGGATTGG + Intronic
1181775860 22:25159731-25159753 TGGTAGAGCTGGATTTGCTCTGG + Intronic
1183827362 22:40398956-40398978 TAGCAGAGCTAGGATTGGACTGG + Intronic
1184507859 22:44914867-44914889 TGGTAGAGCTAGAGATGGAGCGG - Intronic
1185254359 22:49824180-49824202 TGGTAGAGATAGAAATTGAAGGG - Exonic
949905579 3:8855875-8855897 TGGTACAGCTAGGATGGGGCAGG - Intronic
951814367 3:26737064-26737086 AGGTAGAGCTACAAGTGTACTGG - Intergenic
952713985 3:36459861-36459883 TGGTAGAGCTAGAATCCTAAAGG - Intronic
954987547 3:54809116-54809138 TGGTAGAGGTAGTATTTGAAAGG + Intronic
960632911 3:119751490-119751512 TGTCTGAGCTAGAATTGGGCAGG - Intronic
962829919 3:139130994-139131016 AGGTAGAGCAAGAGTTGGTCAGG + Intronic
963749458 3:149160981-149161003 TTGTAGAGCCAGAATTGAATCGG + Intronic
966055830 3:175688408-175688430 TGGGAGAGACAGAATTGGGCTGG + Intronic
966897738 3:184458289-184458311 TAGTAGAGATAGCATTGGCCAGG - Intronic
967941134 3:194767600-194767622 TGGTAGGGCTAGGAGAGGACAGG + Intergenic
969441777 4:7221480-7221502 TGCAAGAGCTGGAATTGAACTGG + Intronic
969451588 4:7276908-7276930 TGGTAGGGCCAGGATTGGAAGGG + Intronic
969947805 4:10802332-10802354 GGGTAGAGCCAGAGTTGGATTGG - Intergenic
971134963 4:23858440-23858462 TGGTAGAGCTAAGATTTGAAAGG + Intronic
974011832 4:56614123-56614145 TGGGAGAGCTTGAATAGGATTGG + Intergenic
974895048 4:67928012-67928034 TAGTGGAGTTAGAATTGGTCAGG + Intronic
979901388 4:126223094-126223116 TTTTAGAGCTAGAAATGGAAAGG + Intergenic
982768835 4:159377592-159377614 TGGTAGAGACAGAGTTGGGCAGG + Intergenic
983695274 4:170520608-170520630 AGGTAGAGCTAGGATGGGAGTGG + Intergenic
987191112 5:15479163-15479185 TGAAAGAGCTAGAAATTGACTGG + Intergenic
990282268 5:54263967-54263989 TGGTAGAGGTAAAAATGGAGAGG - Intronic
990719718 5:58680629-58680651 TGGAGGATCTAGAAGTGGACAGG + Intronic
993594370 5:89834175-89834197 TGGAAGAGCTATATTTGGAATGG - Intergenic
998946609 5:147346710-147346732 TGGTATTGATAGAATTGGATGGG - Intronic
999389361 5:151179169-151179191 TGGAAGAGCTGGAATTTGACAGG + Intergenic
1000554478 5:162708109-162708131 TGGTTGAGCAAGAATTGAAAAGG + Intergenic
1002364608 5:178700240-178700262 TGGAAGAGCTAGACTTGACCAGG - Intergenic
1007813781 6:44505761-44505783 TGGTAGAGCCAGAATTTGACTGG + Intergenic
1009436364 6:63622832-63622854 TGGTAAAGCCAGTATTGGATAGG + Intergenic
1010174172 6:73007343-73007365 TCGCACAGCTAAAATTGGACAGG - Intronic
1011325258 6:86143458-86143480 GGGAAGAGGTAGAATTGGAGAGG - Intergenic
1015168795 6:130228422-130228444 TGGGAGAACCAGAAATGGACGGG + Intronic
1015708740 6:136116564-136116586 TGGGAGAGCCAGAGTTGGTCTGG + Intronic
1017684116 6:156894816-156894838 TCCTAGAGATAGAACTGGACTGG + Intronic
1020755768 7:12201354-12201376 AGGTAGAGGTAGAAATTGACAGG - Intergenic
1023475521 7:40573804-40573826 TGGTAGAGCTGGACTTGAGCAGG + Intronic
1024548020 7:50538613-50538635 TGGTAGAGCTGGGCTTGGCCAGG - Intronic
1028131258 7:87176572-87176594 TGGTAGAAATAGAATTGGTAGGG + Intronic
1030284857 7:107815346-107815368 TGGAAGAGCTTGGATTGGAGAGG + Intergenic
1031739396 7:125410182-125410204 TGGCAGAGCTGGAATTTGTCAGG + Intergenic
1031886540 7:127251460-127251482 TGGTAGAGATAGAAACGGAGAGG - Intronic
1033014135 7:137654455-137654477 TGGTAGTGATAGAATTGAAGGGG - Intronic
1033657734 7:143384385-143384407 TGATAGAGCTATACTTGGAGAGG + Intronic
1042794553 8:72647005-72647027 TGGAAGAGCTAAAAATGGAACGG + Intronic
1045559001 8:103242706-103242728 TGACAGAGCTAGAATTCTACTGG - Intergenic
1050318828 9:4430215-4430237 AGTTGGAGCTAGAATTAGACAGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1050438348 9:5632627-5632649 TGGTAGAGGTAGAACTTGACTGG + Intronic
1051210546 9:14737763-14737785 TGGTAGAGCTAGAATTGGACTGG - Intronic
1052842536 9:33305276-33305298 TGGAGGAGGTAGAATTGAACTGG + Intronic
1053076905 9:35141164-35141186 TGGTAGATCAAGAATTGGGTGGG + Intergenic
1057362002 9:94381923-94381945 TGGAAGGGCTAAAATTGGCCAGG - Intronic
1057411026 9:94816659-94816681 TGGTGGAGCTAGAAGAAGACTGG + Intronic
1057661355 9:97006241-97006263 TGGAAGGGCTAAAATTGGTCAGG + Intronic
1059595428 9:115715038-115715060 TGGTAGAGAGAGCACTGGACTGG + Intergenic
1186795102 X:13039502-13039524 TGATAGAGGGAGAGTTGGACAGG - Intronic
1187249443 X:17583585-17583607 CGGAAGACCTAGATTTGGACTGG + Intronic
1187948616 X:24450643-24450665 TTGTAGACCTAGAAGTGGAATGG - Intergenic
1188341121 X:29003227-29003249 TGGTGGAGCTACAGTTGGAAAGG + Intronic
1188773445 X:34184015-34184037 TGGTAGACCTGGAAGTGCACAGG - Intergenic
1188985842 X:36767706-36767728 CCTTAGACCTAGAATTGGACTGG - Intergenic
1189030515 X:37444864-37444886 TGGTTGAGATAGAATTGGGGGGG - Intronic
1195779243 X:108442200-108442222 TGGTAGGGCTAGTCTTTGACTGG + Intronic
1196043669 X:111233199-111233221 TGGTAGAGGTAACATTGAACGGG - Intergenic
1200918912 Y:8595702-8595724 TGGTACAGACAGAATTGGCCTGG - Intergenic
1201143096 Y:11044730-11044752 TGTTGGAGCTTGAATTGGAGGGG - Intergenic
1201666782 Y:16466499-16466521 TTGTAGAGGTAGACTTGGAAGGG - Intergenic