ID: 1051212461

View in Genome Browser
Species Human (GRCh38)
Location 9:14758996-14759018
Sequence TTCACCTCAGTCACTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051212461_1051212462 -2 Left 1051212461 9:14758996-14759018 CCATGGGAAGTGACTGAGGTGAA No data
Right 1051212462 9:14759017-14759039 AATACTAAGAGAAAGCCTCTTGG No data
1051212461_1051212463 -1 Left 1051212461 9:14758996-14759018 CCATGGGAAGTGACTGAGGTGAA No data
Right 1051212463 9:14759018-14759040 ATACTAAGAGAAAGCCTCTTGGG No data
1051212461_1051212466 17 Left 1051212461 9:14758996-14759018 CCATGGGAAGTGACTGAGGTGAA No data
Right 1051212466 9:14759036-14759058 TTGGGACTGAAATTTGCTCTGGG No data
1051212461_1051212465 16 Left 1051212461 9:14758996-14759018 CCATGGGAAGTGACTGAGGTGAA No data
Right 1051212465 9:14759035-14759057 CTTGGGACTGAAATTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051212461 Original CRISPR TTCACCTCAGTCACTTCCCA TGG (reversed) Intronic