ID: 1051212485 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:14759264-14759286 |
Sequence | CTTTCGAAGGCCAAGGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1051212479_1051212485 | 11 | Left | 1051212479 | 9:14759230-14759252 | CCAGGCAAGGTGGCTCACGCTTG | 0: 15 1: 1065 2: 23396 3: 95807 4: 152467 |
||
Right | 1051212485 | 9:14759264-14759286 | CTTTCGAAGGCCAAGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1051212485 | Original CRISPR | CTTTCGAAGGCCAAGGTGGA TGG | Intronic | ||
No off target data available for this crispr |