ID: 1051212485

View in Genome Browser
Species Human (GRCh38)
Location 9:14759264-14759286
Sequence CTTTCGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051212479_1051212485 11 Left 1051212479 9:14759230-14759252 CCAGGCAAGGTGGCTCACGCTTG 0: 15
1: 1065
2: 23396
3: 95807
4: 152467
Right 1051212485 9:14759264-14759286 CTTTCGAAGGCCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051212485 Original CRISPR CTTTCGAAGGCCAAGGTGGA TGG Intronic
No off target data available for this crispr