ID: 1051215803

View in Genome Browser
Species Human (GRCh38)
Location 9:14796108-14796130
Sequence AAGGTTCTTAAAAAGCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051215803_1051215808 3 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215808 9:14796134-14796156 AGTGGCTCATAGGGAACAGCAGG No data
1051215803_1051215809 9 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215809 9:14796140-14796162 TCATAGGGAACAGCAGGATATGG No data
1051215803_1051215812 20 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215812 9:14796151-14796173 AGCAGGATATGGGGCAGATAAGG No data
1051215803_1051215806 -6 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215806 9:14796125-14796147 AACCTTATCAGTGGCTCATAGGG No data
1051215803_1051215805 -7 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215805 9:14796124-14796146 GAACCTTATCAGTGGCTCATAGG No data
1051215803_1051215810 10 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG No data
1051215803_1051215814 25 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215814 9:14796156-14796178 GATATGGGGCAGATAAGGAAGGG No data
1051215803_1051215813 24 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215813 9:14796155-14796177 GGATATGGGGCAGATAAGGAAGG No data
1051215803_1051215811 11 Left 1051215803 9:14796108-14796130 CCATAATGCTTTTTAAGAACCTT No data
Right 1051215811 9:14796142-14796164 ATAGGGAACAGCAGGATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051215803 Original CRISPR AAGGTTCTTAAAAAGCATTA TGG (reversed) Intronic